Skip to main content

Table 2 Primers used in this study

From: A novel protein fusion partner, carbohydrate-binding module family 66, to enhance heterologous protein expression in Escherichia coli

Amplicon Primer Sequence (5’ to 3’)
CBM66 F1 AGAAGGAGATATACATATGGGAACGACACCT
R1 GTAACGAAGGAGTCTCTCGAGCACCACCAC
CBM66-La F2 GTAACGAAGGAGTCTGGTGGCGGAGGCAGCGGTGGAGGCGGATCC
R2 ATCGTCATCGTCACCGGATCCGCCTCCACCGCTGCCTCCGCCACC
CBM66-L-EKb F3 GGTGGAGGCGGATCCGGTGACGATGACGATAAGXXXXXXXXXXXXXXX
R3 XXXXXXXXXXXXXXXTCAGTGGTGGTGGTGGTGGTGCTCGAG
pMAL-L-EK F4 GGAGATATACATATGAAAATAAAAACAGGT
R4 GCTGCCTCCGCCACCAGTCTGCGCGTCTTT
pGST-L-EK F5 GGAGATATACATATGTCCCCTATACTAGGT
R5 GCTGCCTCCGCCACCTTTTGGAGGATGGTC
pLE F6 AGAAGGAGATATACATATGGGTGGCGGAGGC
  1. aL, flexible linker domain [double repeat of four glycine and one serine, (G4S)2]
  2. bEK, enterokinase cleavage site
  3. X, nucleotides of target genes