Skip to main content

Table 4 Oligonucleotides used in this study

From: Enhanced production of γ-amino acid 3-amino-4-hydroxybenzoic acid by recombinant Corynebacterium glutamicum under oxygen limitation

Name Target gene Sequence (5′–3′) Cohesive endsa
Primer 1 pta-ackA ACGGCCAGTGGAATTCTGCGTGAGATGAAGTAAGGC EcoRI
Primer 2 pta-ackA GGTGTTGGTGAAAATGCCCA  
Primer 3 pta-ackA ATTTTCACCAACACCACGTGTTTCCTACACCGATG  
Primer 4 pta-ackA ATGATTACCCAAGCTTGTCCGTGTCGGATTTCATCA HindIII
Primer 5 alaT ACGGCCAGTGGAATTCCTAGTCCGTTTTCGACGATG EcoRI
Primer 6 alaT ACAGCACGTCCTTCATCTTC  
Primer 7 alaT TGAAGGACGTGCTGTACCCCAACGTGTACGAAATC  
Primer 8 alaT ATGATTACCCAAGCTTAAGTTTCAGGCATAGGCAGG HindIII
Primer 9 avtA ACGGCCAGTGGAATTCTCCATGAGGTCAAGCATGTC EcoRI
Primer 10 avtA CCGATGATTCAGAGGAATGG  
Primer 11 avtA CCTCTGAATCATCGGAGAGCGATCTCTGCTTCTTC  
Primer 12 avtA ATGATTACCCAAGCTTTTGATGGGGAGACTGTGGTT HindIII
Primer 13 cat ACGGCCAGTGGAATTCCGTAAAGCGGAGTTTTAGGC EcoRI
Primer 14 cat ATCTCTGAGTACGGTTACGC  
Primer 15 cat ACCGTACTCAGAGATAACAGGTCGATTGCGTAGTC  
Primer 16 cat ATGATTACCCAAGCTTAGCAACGTTGGTTACACCAG HindIII
Primer 17 ldh ACGGCCAGTGGAATTCTGGGTTAATTCGCCGGTGATCAG EcoRI
Primer 18 ldh GGTTGATCAGTGCAGTATGCGTATG  
Primer 19 ldh CTGCACTGATCAACCCACTGCTCCACGGTGAATACG  
Primer 20 ldh ATGATTACCCAAGCTTGGCAAGGTCCATGCTGACG HindIII
Primer 21 mdh ACGGCCAGTGGAATTCAATGACAACGGCGTGGCTTC EcoRI
Primer 22 mdh TCTGCGGCAATTCCTTCCAC  
Primer 23 mdh AGGAATTGCCGCAGAGGGATCTCCAGAAGTTTCAG  
Primer 24 mdh ATGATTACCCAAGCTTTTTCCATCAATAGCAGGCGC HindIII
Primer 25 pqo ACGGCCAGTGGAATTCTGGTCGCATCTCATCGATTG EcoRI
Primer 26 pqo GCATATCCTGGACCTGTACT  
Primer 27 pqo CAGGATATGCTTTCCAGGACCACAAGAAGC  
Primer 28 pqo ATGATTACCCAAGCTTCTTGCGCCTGCAAAGTTTCT HindIII
  1. aThe restriction site overhangs used in the cloning procedure are underlined