Table 2 Plasmids used and constructed in this study
Plasmid | Description | Source |
|---|---|---|
Generic plasmids and plasmid backbones | ||
pJET1.2-B-KanMX-P | pMB1 ori (E. coli) Backbone for amplification of KanMX marker flanked by attB and attP (attB/P) | MCB, KU Leuven |
pTOPO-G1-NAT-G1 | pMB1 ori (E. coli) Backbone for amplification of NatMX marker flanked by attB/P and G1 recognition site | MCB, KU Leuven |
PhiC31NAT | ColE1 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy), encodes PhiC31 integrase and NatMX marker | |
p426KanMX | pMB1 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy), KanMX marker Backbone for construction of donor DNA | MCB, KU Leuven |
p426hph | pMB1 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy), hph marker Backbone for construction of Mapw and donor DNA | MCB, KU Leuven |
pBEVYhph | ColE1 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy), hph marker Backbone for construction of Mapw | MCB, KU Leuven |
pTEF-Cas9-KanMX (p51) | pBR322 ori (E. coli) and CEN ori (single copy), vector backbone p414-TEF1p-Cas9-CYC1t with auxotrophic marker replaced by KanMX | MCB, KU Leuven |
pgRNA-uni-NAT (p59) | pBR322 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy) gRNA plasmid backbone with NatMX marker | MCB, KU Leuven |
pgRNA-uni-hph (p58) | pBR322 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy) gRNA plasmid backbone with hph marker | MCB, KU Leuven |
p426hph-IS2.1 | Multi copy, homologous regions for IS2.1 with hph marker | MCB, KU Leuven |
p426hph-IS16.2 | p426hph backbone with homologous regions for IS16.2 | MCB, KU Leuven |
Guide RNA plasmids | ||
pgRNA-uni-hph-G1-G2 | P58 backbone with gRNA sequence targeting G1 (GGCTGATTTTCGCAGTTCGG) and G2 (GGATGAGAATCTGACAAAGGG) | MCB, KU Leuven |
p58-ARO4 | p58 backbone with gRNA targeting ARO4 (TTCATGGGTGTTACTAAGCA) | This study |
p58-MTH1 | p58 backbone with gRNA sequence targeting MTH1 (CTAGCTCTATCAGTGTACTC) | This study |
p58-PDC5 | p58 backbone with two gRNA sequences targeting PDC5 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) | This study |
p58-PDC6 | p58 backbone with two gRNA sequences targeting PDC6 (CTATCGAAAAGCTGATTCAT and GCTGATTTGATCCTTTCGGT) | This study |
p59-aroY-Ciso,I218V | p59 backbone with gRNA sequence targeting aroY-Ciso,I218V (TTAGATCCCGCTATCTACGT) | This study |
p59-attL | Multi copy, gRNA for attL site | This study |
p59-IS2.1 | p59 backbone with gRNA sequence targeting the IS2.1 site (ATCAACCACAGTGAACGCCG) | This study |
p59-IS16.2 | p59 backbone with gRNA sequence targeting the IS16.2 site (GTAGAATAAGTGTTTCGGAT) | This study |
Plasmids containing expression cassettes | ||
p426KanMX-PAD1 | p426KanMX backbone with the expression cassette FBA1p; PAD1; ADH2t | This study |
p426hph-IS2.1-PAD1 | p426hph-IS2.1 backbone with the expression cassette FBA1p; PAD1; ADH2t flanked by the homologous regions for genomic integration at IS2.1 | This study |
p426KanMX-aroY-B | p426KanMX backbone with the expression cassette FBA1p; aroY-B; ADH2t | This study |
p426KanMX-DHSD | p426KanMX backbone with the expression cassette TEF1p; aroZpan; CYC1t | This study |
pBEVYhph-CDO-PCAD(aroY-Ciso) | pBEVYhph backbone with the expression cassettes TDH3p - HQD2Ca - ADH1t, ADH1p - aroY-Ciso - ADH2t Together with p426KanMX-DHSD constitutes pMApw(aroY-Ciso) | This study |
pBEVYhph-CDO-PCAD(aroY-Ciso)-DHSD (pMApw) | pBEVYhph backbone with the expression cassettes TDH3p - HQD2Ca - ADH1t, ADH1p - aroY-Ciso - ADH2t, TEF1p - aroZpan - CYC1t Contains the muconic acid pathway (MApw) | This study |
pMApw-PDC1 | pMApw backbone with homologous regions for genomic integration at the PDC1 locus | This study |
pMApw-PDC5 | pMApw backbone with homologous regions for genomic integration at the PDC5 locus | This study |
pMApw-PDC6 | pMApw backbone with homologous regions for genomic integration at the PDC6 locus | This study |
p426hph-IS16.2-AGDC1 | p426hph-IS16.2 backbone with the expression cassette PGK1p - AGDC1 - TPS1t flanked by the homologous regions for genomic integration at IS16.2 | This study |
p426hph-IS16.2-TaGDC1 | p426hph-IS16.2 backbone with the expression cassette PGK1p - TaGDC1 - TPS1t flanked by the homologous regions for genomic integration at IS16.2 | This study |
p426hph-IS16.2-aroY-Ciso | p426hph-IS16.2 backbone with the expression cassette PGK1p - aroY-Ciso - TPS1t flanked by the homologous regions for genomic integration at IS16.2 | This study |
p426hph-IS16.3-ARO3K222L-ARO4K229L | p426hph-IS16.3 backbone with the expression cassettes PGK1p - ARO3K222L - TPS1t, TEF1p; ARO4K229L - ELO2t flanked by the homologous regions for genomic integration at IS16.3 | This study |