Skip to main content

Table 3 List of the oligonucleotides used in this study

From: Maximizing PHB content in Synechocystis sp. PCC 6803: a new metabolic engineering strategy based on the regulator PirC

Primer name Sequence
psbA2fw2 gcttccagatgtatgctcttctgctcctgcaggtcgactcatttttccccattgccccaaaatac
psbA2rv2 gatacgatgacaacgtcagtcattttggttataattccttatgtatttg
RePhaABA2fw caaatacataaggaattataaccaaaatgactgacgttgtcatcgtatc
RePhaABA2rv atgaatgttccgttgcgctgcccggattacagatcctctatcagcccatgtgcaggccgccgttg