Skip to main content

Table 3 Oligonucleotides used in this study

From: Construction and description of a constitutive plipastatin mono-producing Bacillus subtilis

Name Sequence 5′–3′ Purpose
s1009 CTGCCGTTATTCGCTGGATT Integration of degQ gene (Bsubtilis DSM10T) (+ 510 bp) in amyE locus
underlined sequences highlight the Nde I and EcoR I restriction site
s1410 ATTATTAACATATGCGGCGTACCTCATACGGATACAC
s1409 ATTATTAAGAATTCCTCCTTGATCCGGACAGAATC
s1010 AGAGAACCGCTTAAGCCCGA
s1221 GGAAAGTGAAAAAAGGAGAAGG Construction of Pveg::Ppps promoter exchange
s1222 CCTATGCAGGTTTTCAACTGTTATTGATTTGCCAAAATGACAG
s1223 CAGTTGAAAACCTGCATAGG
s1224 TGCATCCACCTCACTACAT
s1225 ATGTAGTGAGGTGGATGCATTGAGCGAACATACTTATTCTTTAAC
s1226 CATTTAAAGAGATTCCATCCATTATGATATG
s1162 CATGATTTTCAGGTCTGCAAGAAC Construction of srfAA-AD:: comS-erm
s1163 GTTCAAACGTCTGCTCCTCCTTAATCTTTATAAGCAGTGAACATGTGC
s1164 AGGAGGAGCAGACGTTTGAAC
s1165 CTTCTCCCTCCAGCAGAAGTAC
s1166 CTTCTGCTGGAGGGAGAAGTAGGTATAAATTTAAC-GATCACTCATCATGTTC
s1167 GACCGATAGATTTTGAATTTAGGTGTC
s1168 CACCTAAATTCAAAATCTATCGGTCGAATGCCAAT-TTCTGCATGGTATAATAG
s1169 GGCAACCTGATGGATAAAGAAATTG