Skip to main content

Table 2 Primers used in this study

From: MAL62 overexpression enhances uridine diphosphoglucose-dependent trehalose synthesis and glycerol metabolism for cryoprotection of baker’s yeast in lean dough

Name 5′ → 3′ DNA  sequences
For recombinant construction
 TU1-F GATGCTGTTGTTCTTTCTTCTGTTT
 TU1-R CCTGCAGCGTACGAAGCTTCAGCTGAGTTCTATGTCTTAATAAGTCTGTA
 KAN1-F TACAGACTTATTAAGACATAGAACTCAGCTGAAGCTTCGTACGCTGCAGG
 KAN1-R GATCGTCTCATTTGCATCGGGTTCAGCATAGGCCACTAGTGGATCTGATA
 TD1-F TATCAGATCCACTAGTGGCCTATGCTGAACCCGATGCAAATGAGACGATC
 TD1-R ACTTTCTAAAATGGCTATATAGGGG
 TU2-R TTCAGTTTTGGATAGATCAGTTAGAAGTTCTATGTCTTAATAAGTCTGTA
 PGKP-F TACAGACTTATTAAGACATAGAACTTCTAACTGATCTATCCAAAACTGAA
 PGKP-R TTTCTGGATGATCAGAAATAGTCATGTTTTATATTTGTTGTAAAAAGTAG
 MAL-F CTACTTTTTACAACAAATATAAAACATGACTATTTCTGATCATCCAGAAA
 MAL-R AGAAAAGAAAAAAATTGATCTATCGTTATTTGACGAGGTAGATTCTACCT
 PGKT-F AGGTAGAATCTACCTCGTCAAATAACGATAGATCAATTTTTTTCTTTTCT
 PGKT-R CCTGCAGCGTACGAAGCTTCAGCTGTAACGAACGCAGAATTTTCGAGTTA
 KAN2-F TAACTCGAAAATTCTGCGTTCGTTACAGCTGAAGCTTCGTACGCTGCAGG
For PCR verification
 UUK-F ATCTAAGAGGACGGTTGCTG
 UUK-R GTCAAGACTGTCAAGGAGGG
 KDD1-F TCGCAGACCGATACCAGGAT
 KDD1-R TCAACGGATGGGAAAGCAAT
 UUP-F GCGGTCCGTTCTGTGGTT
 UUP-R CCCTCTGTGGCGGTCTAT
 PPM-F CACATGCTATGATGCCCACT
 PPM-R CGCAAACAAACGGAGGTA
 MPT-F CGAAAGATAAGCCCAATG
 MPT-R CTGTAACGAACGCAGAAT
 PTK-F AAATTCTGCGTTCGTTAC
 PTK-R CCGTCAGCCAGTTTAGTC
 KDD2-F TATGTGAATGCTGGTCGCTAT
 KDD2-R CCGTTGCTACTGCCGTTA
For RT-qPCR
 qGDB1-F AGCCTAACTTCGGCACTC
 qGDB1-R CACCGTCATCTAATCTCAAATA
 qEMI2-F GGCAAGGATGTCGTGAGGTT
 qEMI2-R AGCCTGAAGTGTAGCAGTGG
 qGLK1-F ATCACGAAGTTGCCACAG
 qGLK1-R TCACCCAAGAACATCCCT
 qHXK2-F TCCGTTTACAACAGATACCC
 qHXK2-R ATAACAGCGGCACCAGCA
 qHXK1-F GTGTCAAGACCACTCTGCCA
 qHXK1-R GGATCTTTGCTTGCGTCACC
 qPGM2-F GAAAAGGACGGTGTTTGGGC
 qPGM2-R GGCTGGGAAGGCGGAATTAA
 qPRM15-F TAAGCAAGACCGCAACCCAA
 qPRM15-R CCAATCCCTGAGACGCTTGT
 qUGP1-F CGAGAGCAACACAAACAGCG
 qUGP1-R CCGGGTTGGGAGACTTGATC
 qTPS1-F GGGGCAAGGTTGTTCTG
 qTPS1-R TCACGGGTGGACGAGAC
 qTPS2-F CCACCACTGCCCAAGACAAT
 qTPS2-R CAGGTTGCGTTCGGTTCTTG
 qTPS3-F TGCTCCGTCTGCTAGAGTCT
 qTPS3-R GGATCGACATCTGGAACGCT
 qUBC6-F [59] GGACCTGCGGATACTCCTTAC
 qUBC6-R [59] TAATCGTGTGTTGGGCTTGA