Table 2 A list of mutations only found in the evolved strains
From: Increased salt tolerance in Zymomonas mobilis strain generated by adaptative evolution
Position | Detected sequence | Locus | Mutation | (annotated) Function | Strains |
|---|---|---|---|---|---|
7181 | C -> T | ZZ6_0006 | A273T | Carboxymethylenebutenolidase | KFS1 and KFS2 |
342703 | C -> T | ZZ6_0303 | G192R | Hypothetical protein | KFS1 and KFS2 |
1641047 | A -> AGGCTCAGGACCCATTGATTT | ZZ6_1449 | Insertion at L282, frame shift | Carboxyl-terminal protease | KFS1 and KFS2 |
1650537 | C -> T | ZZ6_1458 | G139V | Hypothetical protein | KFS2 |