Skip to main content

Table 2 Primers used in this study

From: Molecular characterization and heterologous expression of two α-glucosidases from Metschnikowia spp, both producers of honey sugars

Primer Sequence
Mr-αGluF ATGACTGACGCTATTTGGTGG
Mr-αGluR CTAGTTCTTGACAATGTACAATCTACTCTC
RFpET28F CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGACTGACGCTATTTGGTGGAAAG
RFpET28R GATCTCAGTGGTGGTGGTGGTGGTGGTTCTTGACAATGTACAATCTACTCTCG
D206AF TCAGAATCGCGACTGCTGGTATGTACTCCAAGGTGCAAACCTTTGAGG
D206AR ACCAGCAGTCGCGATTCTGAAACCGTCCACACCCTTCTCGAACCAG
E264QF ACTGTTGGTCAGGTGGGCCACTCTTCTCGTGAAGATGCCTTGAAGTACGTC
E264QR GTGGCCCACCTGACCAACAGTCATGGCGTCGTACTTGGAGGTCACCTTC
D339AF GAGAACCACGCGCAACCAAGATGTATCACTCGTTTCGGTAACGACAGCCCAG
D339AR CATCTTGGTTGCGCGTGGTTCTCGAAGAAACAAGTTGACCATGCATCAGTTCC
  1. Sequences complementary to the insertion site in the pET28b(+) plasmid are underlined. Initial ATG and TAG stop codons are indicated in bold