Skip to main content

Table 3 Primers used in this work

From: The signal peptide of Cry1Ia can improve the expression of eGFP or mCherry in Escherichia coli and Bacillus thuringiensis and enhance the host’s fluorescent intensity

Primer Sequence (5′-3′)
EGFP-F ACGCGGATCCACCATGGGTAAAGGAGAAGAACTTTTCACTG
IEGFP-F ACGCGGATCCACCATGAAACTAAAGAATCAAGAT
IEGFP-fuF ATGAAGATTGTTTGAAAATGATGGGTAAAGGAGAAGAACT
IEGFP-fuR AGTTCTTCTCCTTTACCCATCATTTTCAAACAATCTTCAT
I/EGFP-R GACTCTCGAGTTTGTATAGTTCATCCATGCCA
304I/EGFP-R GAGCTCTTAGTGGTGGTGGTGGTGGTGCT
Pac-F GCCAAGCTTCAGGTAAATGGTTCTAACATGT
Pac-R GGTGGATCCCCTCCATCTCTTTTATTAAGAT
Tac-F GGATCCATCATCGAGCTCGAGGCAAACTCAGGTTTAAATATCGT
Tac-R GGTACCACTGCACAATTGTATTGAATGAT
cry1Ia-F ATAAAAGAGATGGAGGGATCCACCATGAAACTAAAGAATCAAGATAAG
cry1IaD44-F ATAAAAGAGATGGAGGGATCCACCATGTCTGAGTATGAAAATGTAGAG
cry1IaD73-F ATAAAAGAGATGGAGGGATCCACCATGCTAGGCGTTCCTTTTGCAGGACAAG
cry1Ia-R AACCTGAGTTTGCCTCGAGCTCCTACATGTTACGCTCAATATGGAGT
Pi-F CGCCAAGCTTGTATTTATAGGTGTTTGAAGT
Pi-R TGGTGGATCCCCCTCCACTTATACTATTATTTAAT
pelBlaz-F CTTAATAAAAGAGATGGAGGGGATCCACCATGAAATACCTGCTGCCGACC
pelBlaz-R GAAAAGTTCTTCTCCTTTACCCATGGTGGATCTGGCCATCGCCGGCTGGGCAGCGAGGA
torAlaz-F CTTAATAAAAGAGATGGAGGGGATCCACCATGAACAATAACGATCTCTTTCAG
torAlaz-R GAAAAGTTCTTCTCCTTTACCCATGGTGGATCTCGCTTGCGCCGCAGTCGCACGTCG
egfpI-F ATGGATGAACTATACAAACTCGAGCACCACCACCACCACCACATGAAACTAAAGAATCA
egfpI-R TATTTAAACCTGAGTTTGCCTCGAGCTCTTACATTTTCAAACAATCTTCATGAT
mCherry-F ACGCGGATCCACCATGGTGAGCAAGGGCGAGGAGGAT
ImC-fuF ATCATGAAGATTGTTTGAAAATGATGGTGAGCAAGGGCGAG
ImC-fuR CTCGCCCTTGCTCACCATCATTTTCAAACAATCTTCATGAT
304I/mC-R TGGTGAGCTCTTAGTGGTGGTGGTGGTGGTGCTCGAGCTTGTACAGCTCGTCCATG
Hcat-F CATCGGTCAACGGTACCA
Hcat-R TGGCACTGCTGACACTTC
Hcat-Probe FAM-AAGCCAATCATCACCAGCATCAGCCA-BHQ1
gfp-CF GCCCTGTCCTTTTACCAGA
gfp-CR CATCCATGCCATGTGTAATCC
gfp-Probe FAM-CCATTACCTGTCCACACAATCTGCCCT-BHQ1
  1. Restriction sites were underline