Table 1 Plasmids, oligonucleotides and strains used in this study
From: Functional expression of polyethylene terephthalate-degrading enzyme (PETase) in green microalgae
| Name | Description or sequence (5′ to 3′) | Source |
|---|---|---|
| Plasmids | ||
| pIDT_PETase_OPT | Commercially distributed plasmid including codon-optimized PETase gene for expression in C. reinhardtii | This study |
| pBR9_mCherry_Cre | Deposited plasmid, containing codon optimized mCherry-encoding gene | CRC |
| pBR9_PETase_Cre | pBR9 containing PETase-encoding gene for C. reinhardtii from pBR9_mCherry_Cre | This study |
| Oligonucleotides | ||
| Cre_Sh-ble_PETase F | GCAACTGCGTGCACTTCGT | This study |
| Cre_Sh-ble_PETase R | TTCTCGCAAGCAAAGATCAGCGT | This study |
| Strains | ||
| E. coli DH5α | RBC bioscience | |
| C. reinhardtii CC-124 | C. reinhardtii wild type strain carrying nit1 and nit2 mutation | CRC |
| C. reinhardtii CC-503 | Cell-wall-less mutant originated from C. reinhardtii CC-125 | CRC |
| C. reinhardtii CC-124 #1 to #11 | C. reinhardtii CC-124 transformants harboring PETase expression cassette | This study |
| C. reinhardtii CC-503 #12 to #25 | C. reinhardtii CC-503 transformants harboring PETase expression cassette | This study |