Skip to main content

Table 1 Plasmids, oligonucleotides and strains used in this study

From: Functional expression of polyethylene terephthalate-degrading enzyme (PETase) in green microalgae

Name Description or sequence (5′ to 3′) Source
Plasmids   
 pIDT_PETase_OPT Commercially distributed plasmid including codon-optimized PETase gene for expression in C. reinhardtii This study
 pBR9_mCherry_Cre Deposited plasmid, containing codon optimized mCherry-encoding gene CRC
 pBR9_PETase_Cre pBR9 containing PETase-encoding gene for C. reinhardtii from pBR9_mCherry_Cre This study
Oligonucleotides   
 Cre_Sh-ble_PETase F GCAACTGCGTGCACTTCGT This study
 Cre_Sh-ble_PETase R TTCTCGCAAGCAAAGATCAGCGT This study
Strains   
 E. coli DH5α   RBC bioscience
 C. reinhardtii CC-124 C. reinhardtii wild type strain carrying nit1 and nit2 mutation CRC
 C. reinhardtii CC-503 Cell-wall-less mutant originated from C. reinhardtii CC-125 CRC
 C. reinhardtii CC-124 #1 to #11 C. reinhardtii CC-124 transformants harboring PETase expression cassette This study
 C. reinhardtii CC-503 #12 to #25 C. reinhardtii CC-503 transformants harboring PETase expression cassette This study