Skip to main content

Table 2 sequence of the primers used in this study

From: Overproduction of the Flv3B flavodiiron, enhances the photobiological hydrogen production by the nitrogen-fixing cyanobacterium Nostoc PCC 7120

NameSequence (5′–3′)Experiment
rnpB forwardTCGTGAGGATAGTGCCACAGQuantitative RT-PCR analysis
rnpB reverseGGAAGTTTCTTCCCCAGTCC 
flv3B RT forwardTTTGGTGGAAGATGTGCTGC 
flv3B RT reverseGCCAATGTAAGTTAGGCGCA 
patB forwardAGGGGCGATGTAAAGTGGAA 
patB reverseTTGACTGCTCGACTGTAGCA 
hoxE forwardGCGTCACCAGTATCAGCAAG 
hoxE reverseTGGGGCGCTAGGGAAAATAA 
hoxF forwardACCCGGCTGAATCTGGTTTA 
hoxF reverseAAGCCTGTGTTGCGGATTTT 
hoxH forwardCTGGACAGGTAAACGATGCG 
hoxH reverseACAAATCCGCGCTGTAATCC 
hoxY forwardTTTCCTTTGGTGACTGTGCG 
hoxY reverseGGTTGATATCGGCTGCTTGG 
ppatB forwardTATAAGATCTGTCTTTAAATATACATGGTTTGGGCloning of patB promoter
ppatB reverseTATAGAATTCGAGCTCGTCGACCCGGGATCCATCGATGGGCCCCATATAACTTTCTTCCCACCC 
flv3B forwardTAT CCCGGG ATG GTA TCG ATG TCT ACG ACC 
flv3B reverseTAT AGTACT TTA GTA ATA GTT GCC TAC TTT GCG 
Strp forwardAATTCCCCTGCTCGCGCAGGConstruction of the hupL deleted mutant
Strp reverseAGCTTAGTAAAGCCCTCGCT 
all0678 forwardTTCGATATCTAGATCTCGAGTCAATTAATGACTTTTGACTAATTA 
all0678 reverseAGTAGACGGAGTATACTAGTGCAACTTTCGGAGCG 
Strp-all0678 forwardCCTGCGCGAGCAGGGGAATTCATATAACTGCTGTGGCA 
Strp-all0678 reverseAGCGAGGGCTTTACTAAGCTGTTTAAACGCAGAGGGG