Skip to main content

Table 3 Primers used in this study

From: Metabolic engineering and transcriptomic analysis of Saccharomyces cerevisiae producing p-coumaric acid from xylose

ID Name Sequence
Overexpression primers
 1691 Fj_TAL_1_fw AGTGCAGGUAAAACAATGAACACCATCAACGAATATCTGAGC
 1692 Fj_TAL_1_rv CGTGCGAUTTAATTGTTAATCAGGTG
 6785 Ec_aroL_2_fw ATCTGTCAUAAAACAATGACACAACCTCTTTTTCTGA
 6786 Ec_aroL_2_rv CACGCGAUTCAACAATTGATCGTCTGTGC
 1398 Sc_ARO7_1_fw AGTGCAGGUAAAACAATGGATTTCACAAAACCAGAAAC
 1399 Sc_ARO7_1_rv CGTGCGAUTCACTCTTCCAACCTTCTTAGCAAG
 1396 Sc_ARO4_2_fw ATCTGTCAUAAAACAATGAGTGAATCTCCAATGTTCG
 1397 Sc_ARO4_2_rv CACGCGAUTCATTTCTTGTTAACTTCTCTTCTTTG
Verification primers
 904 Sc_X-3-out-seq_rv CCGTGCAATACCAAAATCG
 906 Sc_X-4-out-seq_rv GACGGTACGTTGACCAGAG
 912 XI-3- down-out_rv CACATTGAGCGAATGAAACG
 2220 Sc_ColoPCR_fw CCTGCAGGACTAGTGCTGAG
 1384 Sc_PDC5_Start_fw AAAGCCTCCATATCCAAAG
 1385 Sc_PDC5_End_rv AGGTATGGTTAAAGATCACAC
 1386 Sc_ARO10_Start_fw ACCGAAATTTAAAAAAGCAG
 1387 Sc_ARO10_End_rv GTTTTCGGATAAAACTTCTTC
Knockout primers
 1368 Pdc5 _UP_fw CGTAAACCTGCATTAAG 
 1369 Pdc5 _UP_rv GATCCCCGGGAATTGCCATTGTGTTGTTCTCTTTG
 1370 Pdc5_END_fw GGTACCCAATTCGCCCTAGATTCAACGTTTGTGTA
 1371 Pdc5_END_rv CTAAGATCATAGCTAAAGG
 1372 Aro10_UP_fw GGATAGCCGTCATTTAC
 1373 Aro10_UP_rv GATCCCCGGGAATTGCCAGAGGGTTGATCAGTTAAA
 1374 Aro10_END_fw GGTACCCAATTCGCCCTACTACCAATTGTTCGTTT
 1375 Aro10_END_rv CGATAGGAATGACAGAA
 476 KanMX_UP_fw TGGCAATTCCCGGGGATCACGCTGC AGGTCGACAAC
 477 KanMX_UP_rv AGTGACGACTGAATCCGGTG
 478 KanMX_END_fw AATGGGCTCGCGATAATGTC
 479 KanMX_END_rv TAGGGCGAATTGGGTACCGCCACTAGTGGA TCTGATATCAC
 150 LEU_UP_rv CAGAAGCATAACTACCCATTCC
 151 LEU_END_Fw TGGAAGAGGCAAGCACGTTAGC
 92 URA3_2/3_START_rv CGCTTCCCATCCAGCATTTC
 93 URA3_2/3_END_fw CTGTCGTTCCATTGAAAGC