Skip to main content

Table 2 Primers for gene knockout used in this study

From: High ectoine production by an engineered Halomonas hydrothermalis Y2 in a reduced salinity medium

Name Sequence
ectD-F1 CGCGGATCCATGACAGTCGGCAATACACCTCTC
ectD-R1 AAGGCAGGGCACCCGCTCGCGGTAAGCAT
ectD-F2 TTACCGCGAGCGGGTGCCCTGCCTTGGTGAAA
ectD-R2 CCCAAGCTTTTAAACGCCCGGCTGCCAAG
doeA-F1 CGCGGATCCGTGGCCCAGTGGCGCGTTTCA
doeA-R1 TTGAACACCCCGCCGGTGTGCCAGCCAC
doeA-F2 TGGCACACCGGCGGGGTGTTCAAGCGCTA
doeA-R2 CCCAAGCTTCTACTTCACGAACAGCTG
  1. The restriction sites in primers are underlined