Skip to main content

Advertisement

Table 2 Primers used in this study

From: Efficient expression vectors and host strain for the production of recombinant proteins by Yarrowia lipolytica in process conditions

Primers Sequence (5′ to 3′) Restriction site/utilisation
LYS5-P1 ATAAGAATGCGGCCGCCGACTAAATTTCGACCCAC NotI, LYS5 disruption
LYS5-P2 CGATTACCCTGTTATCCCTAGCGTAACTCGCTACTAGGCCGCCACC I-SceI, LYS5 disruption
LYS5-T1 CGTAGGGATAACAGGGTAATATAGCGTAACTATAACGGTCCTAAGGTAGCGAAGGCGTTGGTGCTCTCTCGGAAGTAG I-SceI, LYS5 disruption
LYS5-T2 ATAGTTTAGCGGCCGCAAAAATGTCCGCCATTGAGTGTTG NotI, LYS5 disruption
LPR-R GCTAGATAGAGTCGAGAATTACCCTG LYS5 prototrophy
LYS5PR TCGGTGCGTGTGAAAGACAC LYS5 prototrophy
preTEYK Fw GTGTTTGACATTTTGTTTTGTGTGAGT Verification of EYK1 disruption
postPEYK Rv TACACACTCACACTCACCAGAACATC Verification of EYK1 disruption
ClaI-pEYD1-Fw CCCATCGATGGAAACCTTAATAGGAGACTACTTCC pEYD1 cloning
no AvrII-pEYD1-Fw CCTCGTGTCCGGGCTAGGGCAGAAACAGCTC pEYD1 cloning, pEYD1 verification
no AvrII-pEYD1-Rev GAGCTGTTTCTGCCCTAGCCCGGACACGAGG pEYD1 cloning
BamHI-pEYD1-Rev TGTGTATGTGTGTGTGTGTGTGTGTGTGTGTTTG pEYD1 cloning
pTEF-internal-Fw TCTGGAATCTACGCTTGTTCA pTEF verification
EYK300-Fw GCATCTACTTTTCTCTATACTGTACGTTTCAATCTGGG pEYK1-3AB, pHU8EYK verification
CalB-prepro-Fw ATGAAGCTGCTGTCTCTGACC CalB verification
CalB-internal-Rev1 CCACCTTAGATCGAATAGAAGGG CalB verification
CalB-Rev TTAAGGGGTGACAATACCAGAAC CalB verification
ACT-F TCCAGGCCGTCCTCTCCC qPCR
ACT-R GGCCAGCCATATCGAGTCGCA qPCR
CalB-internal-Fw TCTCTGCTCCTTCTGTGTGG qPCR
CalB-internal-Rev2 GTCGAACAGAGGTCCACAGA qPCR