Skip to main content

Advertisement

TableĀ 1 UPL primer sets were used to measure relative quantification of each gene by qRT-PCR

From: Characterizing an engineered carotenoid-producing yeast as an anti-stress chassis for building cell factories

Primer name Sequence
crtE-UPL#1-F CGAGATGCTTTCCCTCCATA
crtE-UPL#1-R TTCGCTAGGACACGTCAGACT
crtI-UPL#155-F CCGATCCTTCCTTTTACGTG
crtI-UPL#155-R CGGCACAAGAATGACGATAG
crtYB-UPL#34-F CACTGATCTTATCTTTCCCTTATCG
crtYB-UPL#34-R GTGGTCTCGATAGGCGTCTT
tHMG-UPL#119-F TTCTGCTATGGCGGGTTC
tHMG-UPL#119-R GCTGTAACCAAATTCGAAGCA
CrBKT-UPL#159-F GCTGCTGCAACTGGTTCAC
CrBKT-UPL#159-R GCACTAGCGGAACTAGCAGAA
CZChYb-UPL#157-F CGCCCACAAATTACACCATT
CZChYb-UPL#157-R TCCGAAAAACATACCCCAAG
Kan-UPL#144-F AGACTAAACTGGCTGACGGAAT
Kan-UPL#144-R CATCAGGAGTACGGATAAAATGC
alg9-UPL#132-F CAATCAATGGCCCGTATCAT
alg9-UPL#132-R TGTCTCAGAAGCACAGTTTGG