Skip to main content

Advertisement

Table 1 Variable gRNA targets used in this study

From: CRISPR–Cas9-mediated genomic multiloci integration in Pichia pastoris

Name Location Sequence (5′ → 3′)
PTEF1UP-g1 Chromosome 1 GCAAGATGGTTAAAAGGTGA
PTEF1UP-g2 GAATGGGCAAGATGGTTAAA
PGAPUP-g1 Chromosome 2 ATCGATAATAGTCGCATGTG
PGAPUP-g2 TTTTAAGATTTCAATCTTGA
PFLD1UP-g1 Chromosome 3 GCGGCAGTAATTGATATCGT
PFLD1UP-g2 AGTAATTGATATCGTAGGGT
PAOX1UP-g1 Chromosome 4 AATCCAAATGTCATCATTGT
PAOX1UP-g2 GCGCCTACAATGATGACATT
PAOX1UP-g3 TGGATTTGGTTGACTCATGT
AOXTTDOWN TGACGCTTATTATACCCTTT