Skip to main content

Advertisement

Table 2 List of strains, plasmids and primers used for heparosan biosynthesis in B. megaterium

From: Metabolic engineering of Bacillus megaterium for heparosan biosynthesis using Pasteurella multocida heparosan synthase, PmHS2

Strain/plasmid Description Source/references
Strain
 E. coli DH5α General cloning host Invitrogen
 B. megaterium MS941 Defined protease deficient mutant of parent strain (DSM319) ΔnprM [23, 46]
Plasmids
 pPT7 T7 promoter, antibiotic resistances against ampicillin (in E. coli) and tetracycline (in B. megaterium) MoBiTec GmbH
 pT7-RNAP T7 RNAP gene, xylA promoter, antibiotic resistances against ampicillin (in E. coli) and chloramphenicol (in B. megaterium) MoBiTec GmbH
 pPT7_ PmHS2 pPT7 vector carrying PmHS2 gene This study
 pPT7_X pPT7 vector without PmHS2 gene (negative control strain) This study
Primer name Sequence (5′→3′) Restriction site
PmHS2_F ccgcgGCTAGCATGAAGAGAAAAAAAGAGATGACTCAAATTCAAATAGC NheI
PmHS2_R ccgcgcACTAGTTATAAAAAATAAAAAGGTAAACAGGGGATAAGGTCAG SpeI
pPT7_seq_F CCTTTACCTTGTCTACAAACCCC N/A
pPT7_seq_R GGTTTGCGCATTCACAGTTCTCC N/A