Skip to main content

Advertisement

Table 5 primers used in this study

From: Synthetic engineering of Corynebacterium crenatum to selectively produce acetoin or 2,3-butanediol by one step bioconversion method

Primer Sequence (5′–3′) and restriction site
PalsSF ACCGGTCGACAAAGGAGGGAAATCATGACAAAAGCAACAAAAG (SalI)
PalsSR ACCGGGATCCCTAGAGAGCTTTCGTTTTC (BamHI)
PalsDF ACCGGGATCCAAAGGAGGGAAATCATGAAACGAgAAAGCAAC (BamHI)
PalsDR ACCGGAATTCTTATTCAGGGCTTCCTTC (EcoRI)
PbdhAF ACCGAAGCTTAAAGGAGGGAAATCATGAAGGCAGCAAGATGG (HindIII)
PbdhAR ACCGGGATCCTTAGTTAGGTCTAACAAGG (BamHI)
PalsSDF ACCGCCCGGGAA AGGAGGGAAATCATGACAAAAGCAACAAAAG (SmaI)
PalsSDR ACCGGAGCTCTTATTCAGGGCTTCCTTC (SacI)
PbutA1F ACCGGAATTCATGAGCAAAGTTGCAATGGT (EcoRI)
PbutA2R ACCGAAGCTTCTAGTTGTAGAGCATGCCGC (HindIII)
PbutA3R TAGGCATTGACGGTGTGACCCTTGGCATCAATTGCACTGTCGAAATTAGC
PbutA4F GCTAATTTCGACAGTGCAATTGATGCCAAGGGTCACACCGTCAATGCCTA
Pldh1F ACCGGAATTCATGAAAGAAACCGTCGGT (EcoRI)
Pldh2R ACCGAAGCTTTTAGAAGAACTGCTTCTG (HindIII)
Pldh3R GTAGGATTGCGCGGGTGATGCGAGCCTTCGCAGTCAGCGTAGGTTCCCTT
Pldh4F AAGGGAACCTACGCTGACTGCGAAGGCTCGCATCACCCGCGCAATCCTAC
  1. Restriction sites are underlined and highlighted in bold