Skip to main content

Advertisement

Table 4 Oligonucleotide sequences of comA, PsrfA and CCR-associated genes

From: Genetic variants of the oppA gene are involved in metabolic regulation of surfactin in Bacillus subtilis

Oligonucleotide Oligonucleotide sequences
comA 5′ ATGAAAAAGATACTAGTGATTGATG 3′ 5′ TTAAAGTACACCGTCTGATTTC 3′
PsrfA 5′ AAAATGTCATGAAAGAATCGTTGTAAG 3′ 5′ CGCAAGATTTGAAATGCTCGTGTGA 3′
ccpA 5′ CAAAAGTCTCATCGCCACG 3′ 5′ CGAGATTGAGCCTGATGGTC 3′
cggR 5′ ATCAGGCTTACCGAACCGA 3′ 5′ GCGTCAACCCTAAAACATCC 3′
citB 5′ ACCGTTGTTGCGGCAGTAT 3′ 5′ TCCTGGTGTTGCTGAGCTTC 3′
gapA 5′ CATTCCTACATCAACTGGTGCTG 3′ 5′ CATTCCTACATCAACTGGTGCTG 3′
fbp 5′ ATAACGGCAACCTGCTGATT 3′ 5′ GTATTCGCCTGTCCATAAGTACC 3′
16sRNA 5′ GAGGCAGCAGTAGGGAATCTT 3′ 5′ CCGTGGCTTTCTGGTTAGGT 3′