Skip to main content

Table 3 Primer sequences used in this study

From: Enhanced production of styrene by engineered Escherichia coli and in situ product recovery (ISPR) with an organic solvent

Primer Sequence (5′ → 3′)
FDC-F GCATGAATTCTTGAACTTTAAGAAGGAGATATACATATGCACCACCACCATCACCATAGGAAGCTAAATCCAGCTTTAGAATTTAGAG
FDC-R ATGCTCTAGATTATCATTTATATCCGTACCTTTTCCAATTTTCATTTACTTTGTC
Gibson-F CCGTTTACCGCTACTCTAGAGCGGCCGCTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTTGAACTTTAAGAAGGAGATATACATATGCAC
Gibson-R1 GCACAATGTGCGCCATTTTTCACTTCACAGGTTTATCATTTATATCCGTACCTTTTCCAATTTTC
Gibson-R2 CAGGGAAGTGAGAGGGCCGCGGGCGGCCGCGTAGCGGTAAACGGCAGACAAAAAAAATGTCGCACAATGTGCGCCA