Skip to main content

Advertisement

Table 3 Oligonucleotides used in this study

From: Screening and purification of nanobodies from E. coli culture supernatants using the hemolysin secretion system

Name Sequence (5′→3′)
CALL001 GTCCTGGCTCTCTTCTACAAGG
CALL002 GGTACGTGCTGTTGAACTGTTCC
VHH-SfiI2 GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCTCAGGTGCAGCTGGTGGA
VHH-NotI2 GGACTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT
BamEcoTirM-EHEC CGCGGATCCGAATTCCAGGCGCTTGCATTGACGCCGGAG
XhoHindInt280-EHEC CCGCTCGAGAAGCTTTTACGATGAAACTTTCAGCTCCTCCTG
BamEcoInt280-EHEC CGCGGATCCGAATTCATTACTGAGATTAAGGCTGATAAG
XhoHindInt280-EHEC CCGCTCGAGAAGCTTTTATTCTACACAAACCGCATAGAC
BamEcoEspA-EHEC CGCGGATCCGAATTCATGGATACATCAAATGCAACATCC
XhoHindEspA-EHEC CCGCTCGAGAAGCTTTTATTTACCAAGGGATATTGCTGA