Skip to main content

Advertisement

Table 1 Primers and plasmids used or constructed in this study

From: Production of a human milk oligosaccharide 2′-fucosyllactose by metabolically engineered Saccharomyces cerevisiae

Name Description Reference
Primer Sequence (restriction sites are underlined)  
 F_BF_fkp (BamHI) ATAGGATCCATGCAAAAACTACTATCTTTGCCTCCTAATC This study
 R_BF_fkp (SalI) ATAGTCGACTTATGATCGTGATACTTGGAATCCCTTATCCG This study
 F_BT_fkp (BamHI) ATAGGATCCATGCCGGAGCCGATCTGCTGTTTCCTTC This study
 R_BT_fkp (SalI) ATAGTCGACTTAGCTTCTCGATACCTGTAATCC This study
 F_BO_fkp (BamHI) ATAGGATCCATGCAAAAGTTATTATCCTTACCAC This study
 R_BO_fkp (SalI) ATAGTCGACTTAGCTTCTTGAAACCTGAAGTCCCTTGTCAG This study
 F_LAC12 (SpeI) TCTAGAGCGGCCGCACTAGTGCCACCATGGCAGATCATTCGAGCAG This study
 R_LAC12 (SalI) TCTAGAGCGGCCGCGTCGACTTAAACAGATTCTGCCTCTG This study
 F_fucT2 (SpeI) GG ACTAGTATGGCCTTTAAGGTCGT This study
 R_fucT2 (XhoI) CCGCTCGAGTTAGGCATTATACTTTTGAGACTTAACT This study
Plasmid
 pRS423GPD HIS3, GPD promoter, CYC1 terminator, 2 µ origin, and Ampr [25]
 pRS425GPD LEU2, GPD promoter, CYC1 terminator, 2 µ origin, and Ampr [25]
 pRS426GPD URA3, GPD promoter, CYC1 terminator, 2 µ origin, and Ampr [25]
 pRS425GPD_BF_fkp pRS425GPD harboring fkp from B. fragilis 9343 This study
 pRS425GPD_BT_fkp pRS425GPD harboring fkp from B. thetaiotaomircon This study
 pRS425GPD_BO_fkp pRS425GPD harboring fkp from B. ovatus This study
 pRS423GPD_LAC12 pRS425GPD harboring LAC12 from K. lactics This study
 pRS426GPD_fucT2 pRS425GPD harboring fucT2 from H. pylori This study