Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: Corynebacterium glutamicum as platform for the production of hydroxybenzoic acids

Oligonucleotide Sequence (5′–3′) Restriction site
del_cg3349-54-up-s ACCAAGCTTCATTTTCTAGTTGAGATTCATTATCATAACGCTTGACAGTACAACTATGTC HindIII
del_cg3349-54-up-as GCTTCCGGGGTGAATGACGGAGCCGCTGCGGAGGTTCCAGAGCCACCGCGCTG
del_cg3349-54-down-s CGCAGCGGCTCCGTCATTCACCCCGGAAGCTGGCGCTACGCCCTCCTCGAAC
del_cg3349-54-down-as ACCTCTAGATTTCTGTCTTGAGGGTTCGTGGGGGCTG XbaI
check-cg3349-54-s AAAGGCTCCATGAATTCCTCACGGAGGATCTC
check-cg3349-54-as ACATCACAAGTAGAAACCCGCATTTTCTGTAGTTTTTAC
(A)-aroF*-s TTCGCTCTTCAAAGCTGCTTAAGGAGGCTATCTATGACCGATGAACAGGTGCTGATGACCCCAG SapI
(A)-aroF*-as TACGCTCTTCTGATTTATGCCACGCGTGCGGTCAGCTG SapI
(A)-aroH-s TTCGCTCTTCAAAGTATACCATGGTAAGGAGGTTCAGCATGAACAGAACTGACGAACTCCGTACTGCGCGTATTG SapI
(A)-aroH-as TACGCTCTTCTGATTTAGAAGCGGGTATCTACCGCAGAGGCGAGTTTTTC SapI
(B)-qsuB-s TTCGCTCTTCAATCTCTATCAAGGAGGATCGGCATGCGTACATCCATTGCCACTGTTTGTTTGTC SapI
(B)-qsuB-as TACGCTCTTCTTCGTTAGTTTGGGATTCCCCGCTCGAGGTC SapI
(B)-irp9-s TTCGCTCTTCAATCTCTATCAAGGAGGATCGGCATGAAGATCTCCGAGTTCCTCCACCTGGCAC SapI
(B)-irp9-as TACGCTCTTCTTCGTTACACCATCAGGTATGGTGCAATGGAGGCCAGCTTTTCGCGAGTTTCG SapI
(B)-hyg5-s TTCGCTCTTCAATCTCTATCAAGGAGGATCGGCATGAACCCATCCTCCTTGGTGCTGAAC SapI
(B)-hyg5-as TACGCTCTTCTTCGTTACATGACCACGCCTTCGATTTCCACGAG SapI
(B)-ubiC-s TTCGCTCTTCAATCTCTATCAAGGAGGATCGGCATGTCACACCCCGCGTTAACGCAACTG SapI
(B)-ubiC-as TACGCTCTTCTTCGTTAGTACAACGGTGACGCCGGTAAAAACAGTTCTGTTAG SapI
tkt’-s CATGGATCCAAGGAGGTTCAGCATGACCACCTTGACGCTGTCACCTGAACTTCAG BamHI
tkt’-as AGAGCTCTTCAGCCCATAGCGTGCTCACGGATACCGAAGTG SapI
‘tkt-s TTTGCTCTTCTGGCTCCATCCTCAACGGCATTTCCCTCC SapI
‘tkt-as TCTGAATTCTTAACCGTTAATGGAGTCCTTGGCCGCTGCCAC EcoRI
pMKEx2_own-s CCCTCAAGACCCGTTTAGAGGC
pMKEx2_own-as TTAATACGACTCACTATAGGGGAATTGTGAGC
pEKEx3-s GCAAATATTCTGAAATGAGCTGTTGACAATTAATCATC
pEKEx3-as CGTTCTGATTTAATCTGTATCAGGCTGAAAATCTTCTC
  1. Restriction sites are underlined; SapI cuts outside of its recognition site, the obtained 5′-overhangs after SapI cleavage used for Electra Cloning are shown in bold. In case of native tkt two separate PCR fragments were assembled using Electra Cloning to eliminate an internal SapI restriction site