Skip to main content

Advertisement

Table 2 Nucleotide sequence of signal peptide used in this study and the putative secretory pathway they follow

From: Development an effective system to expression recombinant protein in E. coli via comparison and optimization of signal peptides: Expression of Pseudomonas fluorescens BJ-10 thermostable lipase as case study

Strain name Plasmid name Putative secretion pathway Signal peptide name Signal peptide nucleotide sequence Recombinant lipBJ10 name
BL21-NULL pET-22b(+)
BL21-00 pET-SigPFL00 S(-)-lipBJ10
BL21-01 pET-SigPFL01 SEC PelB ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC PelB-lipBJ10
BL21-02 pET-SigPFL02 SRP DsbA ATGAAAAAAATTTGGCTGGCGCTGGCGGGCCTGGTGCTGGCGTTTAGCGCTAGCGCC DsbA-lipBJ10
BL21-03 pET-SigPFL03 TAT + SEC FhuD ATGAGCGGCCTGCCGCTGATTAGCCGCCGCCGCCTGCTGACCGCGATGGCGCTGAGCCCGCTGCTGTGGCAGATGAACACCGCGCATGCC FhuD-lipBJ10
BL21-04 pET-SigPFL04 TAT + SEC MdoD ATGGATCGCCGCCGCTTTATTAAAGGCAGCATGGCGATGGCGGCGGTGTGCGGCACCAGCGGCATTGCTAGCCTGTTTAGCCAGGCGGCGTTTGCC MdoD-lipBJ10
BL21-05 pET-SigPFL05 SEC OmpA ATGAAAAAAACCGCGATTGCGATTGCGGTGGCGCTGGCGGGCTTTGCGACCGTGGCGCAGGCC OmpA-lipBJ10
BL21-06 pET-SigPFL06 TAT + SEC YcdO ATGACCATTAACTTTCGCCGCAACGCGCTGCAGCTGAGCGTGGCGGCGCTGTTTAGCAGCGCGTTTATGGCGAACGCC YcdO-lipBJ10