Skip to main content

Advertisement

Table 1 Oligonucleotides used in the experiments

From: Development an effective system to expression recombinant protein in E. coli via comparison and optimization of signal peptides: Expression of Pseudomonas fluorescens BJ-10 thermostable lipase as case study

Oligonucleotides Sequence (5′–3′)
PFL-22b (upstream)a CCGCATATGGGTGTCTACGACTACAAAAACC
PFL-22b (downstream)a CCGCTCGAGGGTAATCACAAACGCCTCCG
PFL-SP-22b (upstream)b CCGGAATCCATGGGTGTCTACGACTA
PFL-SP-22b (downstream)b CCGCTCGAGGGTAATCACAAACGCCT
pET-PFL (upstream)c GGGGAATTGTGAGCGGATAAC
pET-PFL (downstream)c TGGCAGCAGCCAACTCAG
16s-reference (upstream)d AATCATCATGCCCCTTATGACC
16s-reference (downstream)d GTTGCAGCCTACAATCCGAAC
PFL-target (upstream)e GGTGGAAGTCCTGGGCAAAT
PFL-target (downstream)e CGCCGATGGAATCAACAA
  1. aPrimers PFL-22b were used to amplify the full-length sequence of lipase gene lipBJ10, with NdeI and XhoI restriction sites (underlined), respectively
  2. bFor fusion with six different signal peptides, primers PFL-SP-22b were used to amplify the full-length sequence of lipase gene lipBJ10, with EcoRI and XhoI restriction sites (underlined), respectively
  3. cPrimers pET-PFL were used to verify the sequence of recombinant plasmid
  4. dPrimers 16s-reference were used to amplify E. coli 16s sequence
  5. ePrimers PFL-target were designed for lipBJ10