Skip to main content

Table 2 Primers were used for random and site directed mutation

From: A novel cold-adapted esterase from Enterobacter cloacae: Characterization and improvement of its activity and thermostability via the site of Tyr193Cys

1 Lip-F: CGCGGATCCATGGCACTGGAAAAGGGT (with BamH I restriction site underlined)
2 Lip-R: CCGCTCGAGTCACTCTCGCCCGGCA (with XhoI restriction site underlined)
3 Lip-V29A-F: GCCAGACAATTGAGGCACTACGAGCA
4 Lip-V29A-R: GCCTCAATTGTCTGGCGACGCGATG
5 Lip-Y193C-F: CCAGTCTTGAAAGCTGTACCCTCAAT
6 Lip-Y193C-R: CAGCTTTCAAGACTGGCCGTAGCGT