Skip to main content

Table 3 Primers used in this study

From: Metabolic engineering of the 2-ketobutyrate biosynthetic pathway for 1-propanol production in Saccharomyces cerevisiae

Target gene Primer (5′–3′) Restriction enzyme
cimA Fw; gggGGATCCatgatggtaaggatatttgatacaa BamHI
Rv; cccCCCGGGttaattcaataacatattgattcct XmaI
cimA Fw; gggCCCGGGatgatggtaaggatatttgatacaa XmaI
Rv; cccGGCGCGCCttaattcaataacatattgattcct AscI
leuC(Cb) Fw; gggGTCGACatgggaatgacaatgactcaaaaaa SalI
Rv; cccCCCGGGCGGCCGCctacactaattcaggatcagttatt NotI
leuD(Cb) Fw; gggGTCGACCCTAGGatgagtgtaaaaggtaaagtattca AvrII
Rv; cccCCCGGGCCGGCCctatctatttcttatatatccaatc FseI
leuC(Ec) Fw; gggGTCGACatggctaagacgttatacgaaaaat SalI
Rv; cccCCCGGGCGGCCGCttatttaatgttgcgaatgtcggcg NotI
leuD(Ec) Fw; gggGTCGACCCTAGGatggcagagaaatttatcaaacaca AvrII
Rv; cccCCCGGGCCGGCCttaattcataaacgcaggttgtttt FseI
leuC(Mj) Fw; gggGTCGACatgggaatgacaattgtagagaaga SalI
Rv; cccCCCGGGCGGCCGCttataaatcccttgggtcaacaagt NotI
leuD(Mj) Fw; gggGTCGACCCTAGGatgagaagtataataaagggaagag AvrII
Rv; cccCCCGGGCCGGCCttattggctttcagccatctttttc FseI
ILV1 Fw; gggGTCGACatgtcagctactctactaaagcaac SalI
Rv; cccGGATCCGCGGCCGCttaatatttcaagaatttttgataa NotI
tdcB Fw; gggGTCGACatgcatattacatacgatctgccgg SalI
Rv; cccGGATCCGCGGCCGCttaagcgtcaacgaaaccggtgatt NotI
ilvA Fw; gggGTCGACatggctgactcgcaacccctgtccg SalI
Rv; cccGGATCCGCGGCCGCctaacccgccaaaaagaacctgaac NotI
asd Fw; CCTAGGatgaaaaatgttggttttatcggctggcgc AvrII
Rv; GGCCGGCCttacgccagttgacgaagcatccgacgcag FseI
thrA Fw; GTCGACatgcgagtgttgaagttcggcggtacatca SalI
Rv; GCGGCCGCtcagactcctaacttccatgagagggtacg NotI
thrB Fw; CCTAGGatggttaaagtttatgccccggcttccagt AvrII
Rv; GGCCGGCCttagttttccagtactcgtgcgcccgccgt FseI
thrC Fw; CCCGGGatgaaactctacaatctgaaagatcacaat XmaI
Rv; GGCGCGCCttactgatgattcatcatcaatttacgcaa AscI
GLY1 Fw; TCACTTGCCATATTCGTTCACCGGTTTTTCTTTTTATTTC  
Rv; caatctgctctgatgccgcatagttaagccACAAAAACCCTAACAATACACATGATGCAACTGGAACGCATGTGTTTATGTTTGCGTTTGTGTGCGGGAG  
URA3 Fw; TGTATTGTTAGGGTTTTTGTggcttaactatgcggcatcagagcagattg  
Rv; GAAAAAAAGGAAGAGGGTAGCAATCCTAAAACAAAAACCCTAACAATACACATGATGCAACTGGAACGCAttagttttgctggccgcatcttctcaaata