Skip to main content

Table 2 The RBS sequences compared in this study

From: Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803

Name and sequence Gene/source Genebank ID/references
S1
CTAGAGTAGTGGAGGTTACTAGATG
Synthetic RBS based on Synechocystis anti-SD [4, 25]
S2
AATATAAGTAGGAGATAAAAACATG
cpcB from Synechococcus sp. PCC 7002 CP000951.1
S3
AGTCAAGTAGGAGATTAATTCAATG
sll1577, cpcB from Synechocystis U34930.1
S4
ATACATAAGGAATTATAACCAAATG
slr1131, psbA2 from Synechocystis X13547.1
S5
TGTTTATGGAGGACTGACCTAGATG
slr0090, rbcL from Synechocystis X65960.1
S6
TAGCCTAGGAGGAGGAAAAATCATG
Synthetic RBS Unpublished construct
S7
CATTAAAGAGGAGAAAGGTACCATG
pDF-lac [20]
A
AACAAAATGAGGAGGTACTGAGATG
Adapted from Salis et al. [12] [3]
B
TTTAACTTTAAGGAGGTTTGGAATG
Adapted from Salis et al. [12] [3]
C
ACTTTAAAGTTAAGAGGCAAGAATG
Adapted from Salis et al. [12] [3]
D
TTTATAAGCAGGACCGGCGGCGATG
Adapted from Salis et al. [12] [3]
E
TAACTTTATTCGCAGGGGGAAGATG
Adapted from Salis et al. [12] [3]
Z
TTTAACTTTACACCATACACTGATG
Adapted from Salis et al. [12] [3]
  1. S2–S5 originate directly from the native cyanobacterial genes and correspond to the NCBI Genbank sequences (22 bp preceding the start codon), while S1 and S6–S7 derive from expression constructs designed earlier for Synechocystis sp. PCC 6803. RBS A–E and Z represent sequences which have earlier been characterized on E. coli. The core SD consensus sequence GGAGG has been underlined, start codon ATG shown in bold, and the upstream insulator sequence identical in all constructs shown in italics