Skip to main content

Table 1 RBSs subjected to in vivo characterization or comparative analysis in Synechocystis sp. PCC 6803 as reported in literature

From: Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803

Name and sequence Organism/source Reporter References
BBa_B0029
ATTCACACAGGAAACCTACTAGATG
NTTCACACAGGAAACCTCTAGAATG
BioBrick mTagBFP
EYFP
[6]
[6]
BBa_B0030
(N)nATTAAAGAGGAGAAA(N)nATG
AATTAAAGAGGAGAAATACTAGATG
NATTAAAGAGGAGAAATCTAGAATG
BioBrick GFPmut3b
mTagBFP
EYFP
[4]
[6]
[6]
BBa_B0031
GATCACACAGGAAACCTACTAGATG
NNTCACACAGGAAACCTCTAGAATG
BioBrick mTagBFP
EYFP
[6]
[6]
BBa_B0032
(N)nTCACACAGGAAAG(N)nATG
AGATCACACAGGAAAGTACTAGATG
NNNTCACACAGGAAAGTCTAGAATG
BioBrick GFPmut3b
mTagBFP
EYFP
[4]
[6]
[6]
BBa_B0033
CTAGATCACACAGGACTACTAGATG
NNNNNTCACACAGGACTCTAGAATG
BioBrick mTagBFP
EYFP
[6]
[6]
BBa_B0034
(N)n AAAGAGGAGAAA(N)nATG
TAGAAAAGAGGAGAAATACTAGATG
NNNNAAAGAGGAGAAATCTAGAATG
BioBrick GFPmut3b
mTagBFP
EYFP
[4]
[6]
[6]
BBa_B0035
GAATTAAAGAGGAGAATACTAGATG
NNATTAAAGAGGAGAATCTAGAATG
BioBrick mTagBFP
EYFP
[6]
[6]
BBa_B0064
TAGAAAAGAGGGGAAATACTAGATG
NNNNAAAGAGGGGAAATCTAGAATG
BioBrick mTagBFP
EYFP
[6]
[6]
psbA2 RBS
AGACATAAGGAATTATTACTAGATG
NNNCATAAGGAATTATTCTAGAATG
psbA2 a mTagBFP
EYFP
[6]
[6]
rbcL RBS
AGATTATGGAGGACTGTACTAGATG
NNNTTATGGAGGACTGTCTAGAATG
rbcL a mTagBFP
EYFP
[6]
[6]
RBS*
NNNNNNTAGTGGAGGTNNNNNNATG
TCTAGATAGTGGAGGTTACTAGATG
NNNNNNTAGTGGAGGTTCTAGAATG
A synthetic RBSa GFPmut3b
mTagBFP
EYFP
[4]
[6]
[6]
Unnamed
NA/GAAGGAGGTNNNNNNNNNNNNATG
A synthetic RBS eCFP and YFP [5]
RBSv4
AAAATAAAGAAGGAGGAACAGCATG
A synthetic RBS Synthetic efe [7]
  1. The sequences (22 bp upstream from the initiation codon) are presented in 5′–3′ direction, with the core SD consensus sequence GGAGG underlined and ATG shown in bold. The nucleotides that have not been specified in the corresponding publications are denoted as N. Comparative studies in which the RBS is not clearly distinguished from the context of the promoter have not been included
  2. aIndicates that the corresponding gene has been used also as the source of RBS sequence in this study