CRISPR/dCas9-mediated transcriptional improvement of the biosynthetic gene cluster for the epothilone production in Myxococcus xanthus

Table 1 The designed spacer sequences based on the promoter of epothilone gene cluster

Name	Spacer	Coding strand	Location	Off-target prediction^a
Epoact1	TGGCCCTTTGAGGGGCTGGC	+	95 bp from TSS1 148 bp from TSS2	145
Epoact2	TCGCGCGATATCGTCGACCC	–	93 bp from TSS1 146 bp from TSS2	21
Epoact3	TTACCCTCGGGGAATTGACT	–	67 bp from TSS1 120 bp from TSS2	9
Epoact4	CATGAAAATGGCCCTTTGAG	+	103 bp from TSS1 156 bp from TSS2	20
Epoact5	TCTCCCAGTCAATTCCCCGA	+	53 bp from TSS1 106 bp from TSS2	18

ISSN: 1475-2859