Skip to main content

Table 2 Primers used in this study

From: Identification, synthesis and regulatory function of the N-acylated homoserine lactone signals produced by Pseudomonas chlororaphis HT66

Primer name Primer sequence (5′–3′)
phzI-F1 TCGGAATTCATGCACATGGAAGAGCACA
phzI-R1 TCGCTCGAGTCAAGCTATCTCTTTCAATAATGT
csaI-F1 TCGGAATTCATGGCGCGGAGCCGGCT
csaI-R1 TCGCTCGAGCTACTCCCTGAGCGCCTGA
hdtS-F1 TCGGAATTCATGTCGATCCTGCAGGCAATCAGAA
hdtS-R1 TCGCTCGAGTCAGATGGCCATTTTGTCCG
ΔphzI-F1 CCGGAATTCCGGACTGAAGGTTGCTGAGAG
ΔphzI-R1 TTACTATCTCCGAGTCGACCATCGAAGGCGACAGTTT
ΔphzI-F2 GGTCGACTCGGAGATAGTAAATGCCCCTC
ΔphzI-R2 CCCAAGCTTCGGTTTGATTTCTTTGCCTACGG
ΔphzR-F1 CCGGAATTCATGGAAGAGCACACACTGAG
ΔphzR-R1 TGTCACATTGAGGGTCTTGCATTTACTATCTCCGAGT
ΔphzR-F2 GCAAGACCCTCAATGTGACAGCCGTAAA
ΔphzR-R2 CCCAAGCTTTTGGCGAAGTTCAAGATGATCATT
ΔcsaI-F1 CCGGAATTCCAGTTGACCGAGGAAGGC
ΔcsaI-R1 TCTACTCCCTGAGCGCCTGAGTAGGTAAAGACACTTG
ΔcsaI-F2 TCAGGCGCTCAGGGAGTAGACCAGCG
ΔcsaI-R2 CCCAAGCTTCGATCCTGTCGTACCTGGC
ΔhdtS-F1 CCGGAATTCACGACTCCGACGCTTACATC
ΔhdtS-R1 CGGTACACAGGTTATCCACAAGGATGTCAGAAGAACT
ΔhdtS-F2 TGTGGATAACCTGTGTACCGTTTTAGCGGAAATCGC
ΔhdtS-R2 CCCAAGCTTCCTCGACGACGATGCC