Table 1 Bacterial strains, plasmids and primers used in this study
Strains, plasmids, and primers | Significant properties | Source or purpose |
|---|---|---|
Strains | ||
 Mycobacterium neoaurum TCCC 11028 M3 (MNR M3) | Wild type | Tianjin University of Science and Technology Culture Collection Center (TCCC) |
 Lactococcus lactis subsp. cremoris NZ9000 | Source of the nox gene | Tianjin University of Science and Technology Culture Collection Center (TCCC) |
 E. coli DH5a | General cloning host | Transgen Biotech |
 MNR M3N1 | MNR M3 containing plasmid pMV261-nox-1 | This work |
 MNR M3N2 | MNR M3 containing plasmid pMV261-nox-2 | This work |
Plasmids | ||
 pMV261 | Mycobacterial replicating vector carrying the BCG hsp60 promoter, kan | Dr. W. R. Jacobs Jr. (Howard Hughes Medical Institute), for providing plasmid pMV261 |
 pMV261-nox-1 | pMV261, contain nox gene from MNR M3, hsp60, kan, BamHI/HindIII | This work |
 pMV261-nox-2 | pMV261, contain nox gene from Lactococcus lactis subsp. cremoris NZ9000, hsp60, kan, BamHI/salI | This work |
Primers | ||
 16 s rRNA-f-RT | ACCAGCGTCCTGTGCATGTC | Quantitative RT-PCR |
 16 s rRNA-r-RT | AGTACGGCCGCAAGGCTAAAAC | Quantitative RT-PCR |
 Nox-1-f-RT | GGAACAGGTACATGGGGTTG | Quantitative RT-PCR for nox-1 |
 Nox-1-r-RT | GAAGTGGCTGGAAGAAGACG | Quantitative RT-PCR for nox-1 |
 nox-1-f | CGCGGATCCAATGAACACCCAGCCGAAAGT | nox-1 amplification |
 nox-1-r | CCCAAGCTTTCAGACCGTGAGGGTGTCCG | nox-1 amplification |
 nox-2-f | 5′-CGGGGATCCGAAAATCGTAGTTATCGGTA-3′ | nox-2 amplification |
 nox-2-r | 5′-GCGTCGACTTATTTGGCATTCAAAGCTG-3′ | nox-2 amplification |
 PMV-f | 5-TAGGCGAGTGCTAAGAATAACGTTG-3 | Amplification |