Skip to main content

Table 1 Information of the 5′-N20-NGG-3′ spacer candidates for the deletion of the biosynthetic gene clusters for myxovirescin and myxalamids

From: Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus

Namea 20 nt spacer sequenceb Hairpin GC (%) ΔGc
11-1 TGCAAATCGGAGTAGAAGCG CGG N 50 −39.6
11-2 GCCGACGCCGCCCTTGATGG TGG N 75 −49.0
11-3 GCGTGAGGAGGAAGCGGCGG TGG N 75 −47.3
11-4 TCCTGTCCGAACCGCCCGCC CGG N 75 −48.4
17-4 GACGAGGCACCTAGAGACAC TGG N 60 −35.8
17-5 CCACTCATCCAGGACGCTAC TGG N 60 −37.8
17-6 CGCGAGGCTGCGGCTGCCAC TGG Y 80 −49.3
17-7 GACGCCCCATCCCCAACCAC TGG N 70 −44.7
17-8 CGAGAGGTCGCTCTCCAAAC TGG Y 60 −39.3
17-9 GGCGATGATGAGGAACCAAC TGG N 55 −39.2
17-10 CCTGCTCCTGCGCCTTCCAC TGG N 70 −44.0
Degenerated NVH-N2-BNH-N2-H-N5-HHAC TGG    
  1. aThe locations are referred to Fig. 4 for 11-1 to 11-4 and Fig. 5 for 17-4 to 17-10
  2. bDisfavored nucleotides are shown in italics
  3. cΔG indicates free energy (kcals/mol). The calculation of free energy and prediction of hairpin in 20 nt spacer were performed by primer premier 5.00
  4. dH: A/T/C, V: G/A/C, B: G/T/C, N: any nucleotide; the C-terminus TGG or CGG is the PAM motif