Skip to main content

Advertisement

Table 4 Primers used to generate fragments for cloning by PCR amplification

From: Scaling up and scaling down the production of galactaric acid from pectin using Trichoderma reesei

Product Primer Sequence Product size (bp)
gar1 5′flank (tre22004) MU01_gar1_5f_for GGTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACTTATATCCACCGTGTCCCAG 1610
MU02_gar1_5f_rev GACGCAGTTGTTTGAGCAAC
trpC terminator (Aspergillus) MU03_trpCt_for GTGGATAACCCCATCTTCAAGCAGTCCTGAGATCCACTTAACGTTACTGAAATCA 803
MU04_trpCt_rev GAGTGGAGATGTGGAGTGGG
gar1 3′direct repeat (tre22004) MU05_gar1_3dr_for TGTGTAAGCGCCCACTCCACATCTCCACTCGGCGCGCCTTGCATTGGTCAGAGCGGTA 361
MU06_gar1_3dr_rev CGAGAGCAGAGCAGCAGTAGTCGATGCTAGGCGGCCGCCCGACTTGGAGAAGCTCGTC
gar1 3′flank (tre22004) MU07_gar1_3f_for CCAGCTGCGATTGATGTGTATCTTTGCATGGCGGCCGCTTGCATTGGTCAGAGCGGTA 1576
MU08_gar1_3f_rev AGCGGATAACAATTTCACACAGGAAACAGCGTTTAAACAAGCAGTGGATGACTTGCTG
cbh1 promoter (tre123989) MU09_cbh1p_for AGGTTAGTAGGTTGCTCAAACAACTGCGTCGGCCGGCCTGTGGCAACAAGAGGCCAGA 1646
MU10_cbh1p_rev GGCAGCGCCGGTGACGAGCAGGCGCTTCATGATGCGCAGTCCGCGGTTGA
cDNA1 promoter (tre123515) MU11_cDNA1p_for AGGTTAGTAGGTTGCTCAAACAACTGCGTCGGCCGGCCGAATTCGGTCTGAAGGACGT 1231
MU12_cDNA1p_rev GGCAGCGCCGGTGACGAGCAGGCGCTTCATGTTGAGAGAAGTTGTTGGATTGA
pdc1 promoter (tre121534) MU13_pdc1p_for AGGTTAGTAGGTTGCTCAAACAACTGCGTCGGCCGGCCAAAGGAGGGAGCATTCTTCG 1370
MU14_pdc1p_rev GGCAGCGCCGGTGACGAGCAGGCGCTTCATGATTGTGCTGTAGCTGCGCT
  1. The gene identifiers (tre-numbers) refer to Joint Genome Institute T. reesei assembly release version 2.0