Skip to main content

Table 2 Primer pairs used in this study

From: Identification of nocamycin biosynthetic gene cluster from Saccharothrix syringae NRRL B-16468 and generation of new nocamycin derivatives by manipulating gene cluster

Primers sequences (5′–3′)
NcmG-delF CTGCTGGGCGCCGACGTGCCGCGCACCACGCCGCGGGTGATTCCGGGGATCCGTCGACC
NcmG-delR CAGGTCCGCCGCCGGTACCGCGAGCCGCAGGGTCGGGAATGTAGGCTGGAGCTGCTTC
NcmB-delF CTGGCCTGCGCCGAACCGCCCGCGCCCGCCTCGCCCGTCATTCCGGGGATCCGTCGACC
NcmB-delR GCCCCGGTGCCCCGCGGGCAGGCGGGCGCCGGGGCCCGCTGTAGGCTGGAGCTGCTTC
NcmL-delF CGCAGCCTGGAGGTGTTCGACGACCTGGGCGTCGTCGACATTCCGGGGATCCGTCGACC
NcmL-delR GAACCCGAAGAGCGTGAAGTGCGGGCCGCGCTGCGCGTCTGTAGGCTGGAGCTGCTTC
NcmG-tF GAGGTCCGGCAGGTGCTGTC
NcmG-tR GACGACCTTGGCGGTGTGCC
NcmB-tF CGGGAGTACTGGCGGCAGC
NcmB-tR GGTCCAGCAGGTCGGCCAGCA
NcmL-tF CTGATCATCGACAAGGACTC
NcmL-tR GGACGAGCACCAGCGCGTCC
DH-SF GCTCGGTGTTCCTGGACCTGGC
DH-SR GCAGTTCGAAGCCGCTCCACAG
NcmG-SF GTCCACCGCGACGCCATAC
NcmG-SR CGGCCAGGTAGTCCTTGAGCC
NcmC-SF GGGCGGTGCTCGGGTTCT
NcmC-SR GCAGGTCGGCGTGGTGGA