Skip to main content

Table 2 Oligonucleotide primers used in this study

From: A new-generation of Bacillus subtilis cell factory for further elevated scyllo-inositol production

Name Sequence (5ʹ → 3ʹ)
a011 CCTTCCAGGGTATGTTTCTC
a014 CGATCAGACCAGTTTTTAATTTGTG
a015 TTAACAAAATTCTCCAGTCTTCACATCG
a125 GATTGCGCGTGCGAAAGAAG
a183 CTTCTTTCGCACGCGCAATCGCCCTGGAATAAGTTTTTGAC
a184 CACAAATTAAAAACTGGTCTGATCGCCAAAAAGAATCCGCAC
a337 GCCCGCAAGAAAAGACGGC
a338 GCTCAGTTAATTCTTTGATGCCATCGATTGGCTTTCTCCCGCTTCC
a339 ATGGCATCAAAGAATTAACTGAGC
a343 CTGTAGACAAATTGTGAAAGG
a344 CTGTTATTGCAATAAAATTAGCC
a345 GGCTAATTTTATTGCAATAACAGCGAAGAAAACAAAAGCTGGCACC
a346 GGCGGGAGAGCAGGGTATTCC
a394 CATCCTGTTTCACCTCCAAATCATATTTAGCCCCAGTTACC
a395 GATTTGGAGGTGAAACAGGATGCGAATTGGCATACCAAGAGAAC
a396 CCTTTCACAATTTGTCTACAGGAGTGACGGCCTCAGCAG
\