Skip to main content

Table 1 Primers used in this study

From: Overexpression of a C4-dicarboxylate transporter is the key for rerouting citric acid to C4-dicarboxylic acid production in Aspergillus carbonarius

Name Sequence (5′ → 3′) Annotation
DctFw AGAGCGAUATGCATGTCCACGACACC SimpleUSER cloning of dct gene
DctRv TCTGCGAUTCATTCAGACACATCCTCGTC SimpleUSER cloning of dct gene
FrdFw AGAGCGAUATGGTTGATGGTCGGTCGT SimpleUSER cloning of frd gene
FrdRv TCTGCGAUTTAGCTACCCGACGGTTCAGTT SimpleUSER cloning of frd gene
GpdFw GGCATTAAUTCGTGGACCTAGCTGATTCTG PCR amplification of expression cassette
TrpRv GGTCTTAAUTCGAGTGGAGATGTGGAGTG PCR amplification of expression cassette
qDctFw TTCCTTCCACCTCAACTGGT qPCR dct gene
qDctRv GCTGAGCAGGACAAAGATGA qPCR dct gene
qActinFw AGAGCGGTGGTATCCATGAG qPCR beta-actin gene
qActinRv TGGAAGAGGGAGCAAGAGCG qPCR beta-actin gene