Skip to main content

Table 2 Sequences upstream of the FPS1 ORF in the four expression constructs used in this study

From: Constitutively-stressed yeast strains are high-yielding for recombinant Fps1: implications for the translational regulation of an aquaporin

Vector name Sequence (sense strand; 5′ to 3′) Reference
pYX222-FPS1-HA3 …TAACTACAAAAAACACATACAGGAATTCACCATGGATCTCATAGTGAGAAGGCGCAATTCAGTAGTTAAAAGCGGGGAACAGTGTGAATCCGGAGACGGCAAGATTGCCCGGCCCTTTTTGCGGAAAAGATAAAACAAGATATATTGCACTTTTTCCACCAAGAAAAACAGGAAGTGGATTAAAAAATCAACAAAGTATAACGCCTATTGTCCCAATAAGCGTCGGTTGTTCTTCTTTATTATTTTACCAAGTACGCTCGAGGGTACATTCTAATGCATTAAAAGACATGAGTAATCCTCAAAAAGCTCTAAACGACTT … [8]; Additional file 1: Figure S2
pYX222-5′Δ1-43-FPS1-HA3 …TAACTACAAAAAACACATACAGGAATTCGCGGGGAACAGTGTGAATCCGGAGACGGCAAGATTGCCCGGCCCTTTTTGCGGAAAAGATAAAACAAGATATATTGCACTTTTTCCACCAAGAAAAACAGGAAGTGGATTAAAAAATCAACAAAGTATAACGCCTATTGTCCCAATAAGCGTCGGTTGTTCTTCTTTATTATTTTACCAAGTACGCTCGAGGGTACATTCTAATGCATTAAAAGACATGAGTAATCCTCAAAAAGCTCTAAACGACTT … This study; Additional file 1: Figure S3
pYX222-5′∆1-43-uORF2-stop-removed-FPS1-HA3 This study; Additional file 1: FigureS4
pYX222-5′Δ1-215-FPS1-HA3 …TAACTACAAAAAACACATACAGGAATTCCATGAGTAATCCTCAAAAAGCTCTAAACGACTT … This study; Additional file 1: Figure S5
  1. Four vectors were used in this study; their construction is described in the “Methods” section and their sequences are given as Additional file 1, as indicated. The sequences directly upstream of the FPS1 ORF (in bold), are shown. The uORFs are underlined; uORF1 is 34 codons long; uORF2, which is found natively in the genomic FPS1 sequence, is 3 codons long. The two additional cytosines in pYX222-5′∆1-43-uORF2-stop-removed-FPS1-HA3 are italicised and the consequent extension of uORF2 is highlighted in grey
\