Skip to main content

Advertisement

Table 1 Primers, plasmids, and Escherichia coli strains used in this study

From: Isoprene production by Escherichia coli through the exogenous mevalonate pathway with reduced formation of fermentation byproducts

Names Descriptions References
Primersa   This study
 PaispS-F AGACGGTCTGCCAATTATGAACC This study
 PaispS-R CTCTAGATTATCTCTCAAAGGGTAGAATAG This study
 PtispS-F GCC ATG GCATGTTCTGTAAGCACAG This study
 PtispS-R CTCTAGATTATCTCTCAAAGGGTAGAATAG This study
 KispS-F TCTCTGGAAAATGACCTTAAGG This study
 KispS-R CTCTAGATTAGCAGCCGGATCCCACGTAC This study
 sPtispS-F GCC ATG GCTTGCTCTGTATCCAC This study
 sPtispS-R CTCTAGATTAGCGTTCGAACGGCAGAATTG This study
 MVA-F GTCTAGATACCTGACGCTTTTTATCGCAAC This study
 MVA-R GTCTAGAGTTTCGATAAGAGCGAACGG This study
Plasmids
 pTrc99A Ptrc expression vector, pBR322 origin, lacIq, Ampr [23]
 pTrc99S pTrc99A containing strong RBS This study
 pSTV28 Plac expression vector, pACYC184 origin, lacZ, Cmr Takara
 pT-PaispS pTrc99A containing ispS from P. alba This study
 pT-PtispS pTrc99A containing ispS from P. trichocarpa This study
 pT-KispS pTrc99A containing ispS from Kudzu vine This study
 pT-sPtispS pTrc99A containing codon optimized ispS from P. trichocarpa This study
 pTS-sPtispS pTrc99S containing codon optimized ispS from P. trichocarpa This study
 pTS-sPt-MVA pTS-sPtispS containing MVA pathway from plasmid pS-NA This study
 pS-NA pSTV28 containing mvaE and mvaS from E. faecalis; mvaK1, mvaK2, and mvaD from S. pneumoniae; and idi from E. Coli [19]
Strains
 MG1655 E. coli K-12; Fλ, ilvG, rfb-50, rph-1 ATCC 700926
 AceCo MG1655 ΔackA-pta, poxB, ldhA, dld, adhE, pps, atoDA Additional file 1: Table S1
 DH5α E. coli K-12; F, φ80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17 (rK mK+), phoA, supE44, λ, thi-1 ATCC 98040
 MGpPapM MG1655 harboring pT-PaispS and pS-NA This study
 MGpKpM MG1655 harboring pT-KispS and pS-NA This study
 MGpPtpM MG1655 harboring pT-PtispS and pS-NA This study
 MGpsPtpM MG1655 harboring pTS-sPtispS and pS-NA This study
 MGpsPtM MG1655 harboring pTS-sPtispS-MVA This study
 ApsPtM AceCo harboring pTS-sPtispS-MVA This study
  1. aStart codons are presented in bold, and restriction sites are underlined