Table 1 List of strains, plasmids, and primers used in this study
Name | Description | Refs |
|---|---|---|
Strains | ||
DH5α | F − , Φ80lacZ·ΔM15·ƒ(lacZYA−argF)U169 deoR recA1 endA1 hsdR17(rk−, mk+) phoA supE44 thi-1 gyrA96 relA1 | Enzynomics |
MG1655 | F−, λ−, ilvG −, rfb-50, rph1 | ATCC 700926 |
BL21(DE3) | BL21 F−, dcm ompT hsdS (rB- mB-) gal λ(DE3) | Enzynomics |
Plasmids | ||
pSSN12Didi | pSTV28 containing mvaK1, mvaD, mvaK2 of Streptococcus pneumoniae, and idi of E. coli | [19] |
pPROLar.A | Plac/ara-1 expression vector, Kanr, p15A ori | Clontech |
pTrc99A | P trc expression vector, Ampr, lacIq, pBR322 ori | GE Healthcare |
pTSN-MrBBS | pTrc99A containing MrBBS of Matricaria recutita | This study |
pPR-IspA | pPROLar.A containing ispA of E. coli | This study |
pTSN-MrBBS-IspA | pTSN-MrBBS containing ispA of E. coli | This study |
pSNA | pSTV28 containing mvaK1, mvaK2, and mvaD of S. pneumoniae, idi of E. coli, and mvaE and mvaS, of Enterococcus faecalis | [19] |
pSNA-MrBBS | pSNA containing MrBBS of M. recutita | This study |
pSNA-MrBBS-IspA | pSNA-MrBBS containing ispA of E. coli | This study |
Primersa | ||
Bis-IF | aggttaaaccatgagcacactgagcgtcag | This study |
Bis-IR | cgactctagattagactatcatcggatgta | This study |
Bis-VF | gatagtctaatctagagtcgacctgcaggc | This study |
Bis-VR | gtgtgctcatggtttaacctcctgtgtgaaattgttatc | This study |
IspAI-F | ggtaccccatatggactttccgcagcaact | This study |
IspAI-R | tgcctctagattatttattacgctggatga | This study |
IspAV-F | taataaataatctagaggcatcaaataaaa | This study |
IspAV-R | gaaagtccatatggggtacctttctcctct | This study |
IspAop-IF | acatccgatgatagtctaatattcattaaagaggagaaag | This study |
IspAop-IR | tgcatgcctgcaggtcgactctagattatttattacgctg | This study |