Skip to main content

Table 3 Sequences of primers used for analysis of AADH2 expression levels

From: Aadh2p: an Arxula adeninivorans alcohol dehydrogenase involved in the first step of the 1-butanol degradation pathway

Primer Sequence (5′→3′)
Oligo(dT)15 V-RTA TGACAGGATACCATACAGACACTATTTTTTTTTTTTTTTV-wobbles
RTA-1 TGACAGGATACCATACAGACAC
RTA TGACAGGATACCATACAGACACTA
ADH2-1 TATGCAGGCCGGTGATCT
ADH2-2 GGACGTGCAGTCATTGATC
ADH2-3 ATTCTCAACCGTATGCAGG
ADH2-4 GATCTTCCTGGACGTGCA
ALG9-1 CATGGGCCAAGGTATACTG
ALG9-2 GAAAAAGTGCCCAAACGA
ALG9-3 TGGTATCGGTCGCATTCT
ALG9-4 TCAATTGCAGTGGACTGACTA
TFllD-1 ACGAGCGGTACTCACAATG
TFllD-2 ATGGACTCAATGTCAAACGAC
TFllD-3 AGTTTGTGTCTGATATTGCCTC
TFllD-4 TGGCCGATTATGGACTCA
TFC1-1 TGAAGAAGAGCACCAAGCA
TFC1-2 ACAACAAGATGAAAACGC
TFC1-3 ATGATGACGATGATGACGAAT