Skip to main content

Table 2 Primers used in this study

From: Display of a β-mannanase and a chitosanase on the cell surface of Lactobacillus plantarum towards the development of whole-cell biocatalysts

Primer Sequencea 5′→3′ Restriction site underlined
Man3050F TGCTTCATCAGTCGAC CACACCGTTTCTCCGGT SalI
ManR1 TGAGATGAGTTTTTGTTCTTCCACGACAGGCGTCAAAGAAT  
ManR2 TCAGATCCTCTTCTGAGATGAGTTTTTGTTCTTCCACGAC  
3050R3 GTTCAGTGACACGCG T CAGATCCTCTTCTGAGATG MluI
Man1261F GATTGCGGCGGTCGAC CACACCGTTTCTCCGGT SalI
1261R3 CCGGGGTACCGAATTC TTACAGATCCTCTTCTGAGATG EcoRI
Csn3050F TGCTTCATCAGTCGAC GCGGGACTGAATAAAGATC SalI
CsnR1 TGAGATGAGTTTTTGTTCGTCGACAGATCCTTTGATTAC  
CsnR2 CAGATCCTCTTCTGAGATGAGTTTTTGTTCGTCGACAGA  
Csn1261F GATTGCGGCGGTCGAC GCGGGACTGAATAAAGATC SalI
  1. aThe nucleotides in italics are the positions that anneal to the DNA of the target gene (manB or cnsA)