Skip to main content

Table 3 Primers used in this study

From: Characterization of a panARS-based episomal vector in the methylotrophic yeast Pichia pastoris for recombinant protein production and synthetic biology applications

Primer name Primer sequence Notes
AA_B1_BstB1_BFP_fw AAGTTCGAAACGATGTCTGAATTGATTAAAGAGAATATG  
AA_B3_EcoR1_BFP_rev AGGGAATTCTCATTAGTTCAATTTGTGTCCTAACTTA  
AB_A8_AOX1end_Rv CGTTTCGAATAATTAGTTGTTTTTTGATCTTCT  
AB_A9_pARS1_GOIend_Fw GAATTCCAACCTGCGATTGATCT  
qPCR-PpACT1-Fw (ACT1, Set 1) CCATCCATTGTGCACCTCAAG [35]
qPCR-PpACT1-Rv (ACT1, Set 1) CGTCTAGAAGCTGAACGACAAG [35]
qPCR-PpACT1_2_Fw (ACT1, Set 2) CGAATCTGGACCATCCATTGTG  
qPCR-PpACT1_2_Rv (ACT1, Set 2) ACGACAAGTAGACACCACCAATC  
qPCR_pEM7_1_Fv (Zeo, Set 1) ACGACAAGGTGAGGAACTAAACC  
qPCR_ZEO_1_Rv (Zeo, Set 1) AAGTCGTCCTCCACGAAGTC  
qPCR_pEM7_2_Fv (Zeo, Set 2) CGACAAGGTGAGGAACTAAACC  
qPCR_ZEO_2_Rv (Zeo, Set 2) GAAGTCGTCCTCCACGAAGTC  
qPCR_BFP_1_Fw (BFP, Set 1) AGACGGTGGAGTTTTGACTGC  
qPCR_BFP_1_Rv (BFP, Set 1) AATGTCTCAGTGAATGCCTCCC  
qPCR_BFP_2_Fw (BFP, Set 2) ACGGTGGAGTTTTGACTGCTAC  
qPCR_BFP_2_Rv (BFP, Set 2) TGAATGCCTCCCATCCCAATG