Skip to main content

Table 1 Primers used in this study

From: Revisiting overexpression of a heterologous β-glucosidase in Trichoderma reesei: fusion expression of the Neosartorya fischeri Bgl3A to cbh1 enhances the overall as well as individual cellulase activities

Primer Sequence (5′–3′) Usage
Trcbh1pF TGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGATATCTAGAGTTGTGAAGTCGG Cloning of cbh1 promoter
Trcbh1Pr GCACAATACGACTCCGGCGCTGGCCGATGCGCAGTCCGCGGTTGACTATT Cloning of cbh1 promoter
TrCBH1F CCCAATAGTCAACCGCGGACTGCGCATCATGTATCGGAAGTTGGCCGTCATCTCGGCC Cloning of cbh1 structural gene
TrCBH1R CACCAGAACCGTAGCGCTTGTCGCGCTCGAGCAGGCACTGAGAGTAGTAAGGGTTCAGG Cloning of cbh1 structural gene
NfBgl3AF TTACTACTCTCAGTGCCTGCTCGAGCGCGACAAGCGCTACGGTTCTGGTGGCAGCAACTGGGATC Cloning of NfBgl3A gene
NfBgl3AR TACGGGCTCACCAAGAATCTACCGGTGCGTCAGGCTTTCGCCACGGAGCTTCACCATCCGC
GACGGACCCTGAAAGAG
Cloning of NfBgl3A gene
Trcbh1tF ACCACCACCACCACCACTAACTCGAGAGCTCCGTGGCGAAAGCCTGACGCACCGG Cloning of cbh1 terminator
Trcbh1tR CCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGGCGGCCGCAACA CTTCGGTGGAGGTGTCGAGTACG Cloning of cbh1 terminator
Yz-Trchb1F GTTCGGACCCATTGGCAGCACCGG Screening of positive transformants
Yz-NfBgl3AR AAGC GGATACCTAGCGGCGAGTCCTG Screening of positive transformants
q-NfBgl3AF AATGGGCGCTGAGGCGAAGGGAC qRT-PCR
q-NfBgl3AR TGAGAGCGGTGGTATCCACG qRT-PCR
q-tef1α-F ACCAAGGCTGGCAAGTTC qRT-PCR
q-tef1α-R GACACCAGTCTCGATACG qRT-PCR