Skip to main content

Advertisement

TableĀ 2 Oligonucleotides used in this study

From: Development of an efficient autoinducible expression system by promoter engineering in Bacillus subtilis

Primer Nucleotide sequence of primera, b
P1F TTTGTT ACTTCCTAGAATATATATTATGTAAACT CTTGATATGGCTTTTTATATGTG
P1R GCAGAAGTTTACATAATATATATTCTAGGAAGTTCAGTCCTGCTCCTCGGCCACGAAG
P2F AGTACTCGCTGAAAGTCCTGTTGCTGC
P2R ATCAAGAGTTTACATAATATATATTCTAGGAAGT AACAAATCTCCTTAATTACAAAGCG
P3F ACTGA ACTTCCTAGAATATATATTATGTAAACT TCTGCAGTGCAGGCTAGCTTTTTTGTGC
P3R CCGACGAACAAACCTGCCAGAAGCCC
P11F ACTTTTCACCCATTTTTCGGTTGACAAAAACATTTTTTTCATTTAAACTGAACGGTA
P11R TTTAAATGAAAAAAATGTTTTTGTCAACCGAAAAATGGGTGAAAAGTTTCATGCGGG
P12F ATAAAAACATTTTTTTCATTTATAATGAACGGTAGAAAGATAAAAAATATTGAAA
P12R TTTTATCTTTCTACCGTTCATTATAAATGAAAAAAATGTTTTTATCACCGAAAAA
P13F ACTTTTCACCCATTTTTCGGTTGACAAAAACATTTTTTTCATGTAAACTGAACGGTA
P13R TTTACATGAAAAAAATGTTTTGTCAACCGAAAAATGGGTGAAAAGTTTTCATGCGGG
P14F ATAAAAACATTTTTTTCATGTATAATGAACGGTAGAAAGATAAAAAATATTGAAA
P14R TTTTATCTTTCTACCGTTCATTATACATGAAAAAAATGTTTTTATCACCGAAAAA
P15F ACTTTTCACCCATTTTTCGGTTGACAAAAACATTTTTTTCATGTATAATGAACGGTAGAAAGATAAAAAATATTGAAA
P15R TTTTATCTTTCTACCGTTCATTATACATGAAAAAAATGTTTTTGTCAACCGAAAAATGGGTGAAAAGTTTCATGCGGG
P16F TGTTAGTTCATAAGAATTAAAATTTATGAATATAAAGTATAGTGTGTTATACTTGCTGATATGAGAAAATGCGTTGCACATGGGATAAGAAA
P16R GCATTTTCTCTTTCTTATCCATATCAGCAAGTATAACACACTATACTTTATATTCATAAATTTTAATTCTTATGAACTAACAGCCG
P17F AAGCTGATATGGATAAGAAAGTTTAAAAGAATTGTGAGCGGGAATACAACAACCAACACCAATTAAAGGAGGAAGACAATGATGAGTAAAGGAGAAGAACTTTTCACTGGAG
P17R TTCTTCTCCTTTACTCATCATTGTCTTCCTCCTTTAATTGGTGTTGGTTGTTGTATTCCCGCTCACAATTCTTTTAAACTTTCTTATCCATATCAGCTTTTAATTCTTATGAACTAACAGCCG
P18F TGTTAGTTCATAAGAATTAAAATTGACAAATATAAAGTATAGTGTGTTATAATGCTGATATGGATAAGAAAGAGAAAATGC
P18R TTTCTTATCCATATCAGCATTATAACACACTATACTTTATATTTGTCAATTTAATTCTTATGAACTAACAGCCGAAATAG
P19F TGTTAGTTCATAAGAATTAAAATTGACAAATATAAAGTATAGTATGTTATACTTGCTGATATGGATAAGAAA
P19R CCATATCAGCAAGTATAACATACTATACTTTATATTTGTCAATTTTAATTCTTATGAACT
P28F CTGCTTATAAAGATTAGGGGAGGTATGACAATGATGAGGAAAAAAACGAAAAACAG
P28R CCGCACAGATGCGTAAGGAGAAAATACCGCTTATTGTGCAGCTGCTTGTACG
P29F CTGCTTATAAAGATTAGGGGAGGTATGACAATGATGAAAAAGCTTTTGACTGTC
P29R CCGCACAGATGCGTAAGGAGAAAATACCGCTTATTTGATATCTTCAAAAATG
P30F CTTCAATAATATTGAAAAAGGAAGAGTGCGGCCGCATCGACAAAAATGTCATGAA
P30R CAAAGGGGGAAATGGGATCCGAGCTCCCGCGGTTATTTGTATAGTTCATCCATG
  1. aHomologous sequences were underlined; dif B. subtilis sequence was shown in bold and the mutant sequences were shown in italic bold
  2. bThe nucleotide sequence of primers P20R/F, P22R/F, P24R/F and P26R/F were the same as P18R/F; the nucleotide sequence of primers P21R/F, P23R/F, P25R/F and P27R/F were the same as P19R/F