Skip to main content

Advertisement

Table 1 PCR primers used in this study

From: The amyR-deletion strain of Aspergillus niger CICC2462 is a suitable host strain to express secreted protein with a low background

Primers Sequence (5′–3′) Enzyme sits
amyR3SH ACTAGTGCCCCCTACATCTGCTATT SpeI
AAGCTTCCACCACCATCAAAATCAC HindIII
amyR3KX GGTACCTGCCCCCTACATCTGCTATT KpnI
CTCGAGTTCCACCACCATCAAAATCAC XhoI
amyR5 TCTAGACCAGATGTGCTCAAGGAATG XbaI
GGTACCAGAAGCGTAGGCTGAACCAT KpnI
glaA GACAATGGCTACACCAGCAC  
AATCACACCAGGAGCAGGAC  
amyR CGAGCCGTTCTCTCAGTTTC  
TGGTGGCAATCTTGTTGAAG  
amyA GCCCATCTACAAAGACGACA  
ACATTTCCATCCGAACCAAC  
actA CCACGAGACCACCTTCAACTCCA  
CCACCGATCCAGACGGAGTACTTGC  
creA CGCAATCACCATTTGTTCAG  
TGGGAGAGGAAGGAGCAGT