Skip to main content

Advertisement

Table 7 Primers used in the qRT-PCR

From: RNA-Seq analysis uncovers non-coding small RNA system of Mycobacterium neoaurum in the metabolism of sterols to accumulate steroid intermediates

SRNA ID Product length (bp) Sense Primer (5′–3′) Anti-sense primer (5′–3′)
131 202 CTACCGCCCCGAAAGTCT AGGACAGACAAGGCAACAGC
138 150 CTCGTTCTGCTTCTCGTC ACATACGGCTGGAACATC
112 180 CTGTTCGGCCAGGGTCAG GAATTCGTGGTCTCCGTCAC
181 146 CTTCCTCCAACCCTTCAC GATTCGACACCCCATACC
222 55 TGTACTCCTCGTCGGTGA TTGCAGGAGTTGGAGACA
122 112 GTGGAAGACCCCACTGAC GGTGCGACTACTGGTGAA