Skip to main content

Advertisement

Table 1 Primers used for RT-qPCR

From: Structural and functional features of self-assembling protein nanoparticles produced in endotoxin-free Escherichia coli

Gene Primer Sequence Amplicon length (bp)
tig ECtig353F AGGGTCTGGAAGCGATCGAAG 301
ECtig653R GGGAAGGTCACGTCGATGGT
ibpA ECibpA85F CAGAGTAATGGCGGCTACCCT 299
ECibpA383R GCTTCCGGAATCACGCGTTC
hscB EChscB191F CGTTAATGCGCGCGGAATATTTG 301
EChscB491R AGTTGTTCGGCACTGCTTCG
hchA EChchA398F TCGCGGATGTTGTTGCCAG 300
EChchA697R CGCCGAAGTACCAGGTGAGA
grpE ECgrpE278F ACGAATTGCTGCCGGTGATTG 301
ECgrpE578R GCTACAGTAACCATCGCCGC
groL ECgroL583F TTCGACCGTGGCTACCTGTC 301
ECgroL883R GGGTTGCGATATCCTGCAGC
dnaK ECdnaK504F CATCAACGAACCGACCGCAG 300
ECdnaK803R TTTTCTGCCGCTTCTTTCAGGC
clpB ECclpB426F AATGCGTGGAGGTGAAAGCG 300
ECclpB725R ATATCCAGCGCCAGTACCCG
clpA ECclpA287F AGTCCTCCGGTCGCAATGAG 300
ECclpA586R CCAGCTCCTTCTCACGACCA
cbpA ECcbpA477F GCTGAATGTGAAGATCCCGGC 300
ECcbpA776R ACCAGACCTTTGCCTTTAACGC
ihfB a ECihfB9F GTCAGAATTGATAGAAAGACTTGCCACC 258
ECihfB266R CGATCGCGCAGTTCTTTACCAG
  1. a Used for normalization of gene expression