Skip to main content

Advertisement

Table 2 Primers used in this study

From: Homogeneity and heterogeneity in amylase production by Bacillus subtilis under different growth conditions

Primers Sequence (5´–3´)
P amy OV rv TTCTTCTCCTTTACGCATGTTTCCTCTCCCTCTCATTTTC
gfp OV fw ATGCGTAAAGGAGAAGAACTTTTCACTG
gfp OV rv2 CTTTTTTTGTCCATTTCTCTTATTTGTATAGTTCATCCATGCC
gfp OV fw 3 CAATGAGAAAAGGAGAAGAACTTTTCACTG
M gfp fw GAGAAATGGACAAAAAAAGCAAAGGGTTC
M gfp rv3 TTCTTCTCCTTTTCTCATTGTTGCCACGTAACAGTAATG
tetM OV fw TTAATACTAGTTCACTAAGTTATTTTATTGAACATATATCG
tetM OV rv TCTGAAAAGGGAATGAAAATTATTAATATTGGAGTTTTAGCTC
KM OV fw2 AATAAAATAACTTAGTGAACTAGTATTAATCTGTTCAGCAATC
KM OV rv2 TAATTTTCATTCCCTTTTCAGATAATTTTAGATTTGC