Skip to main content

Table 3 Primers used in this study

From: Characterisation of the broad substrate specificity 2-keto acid decarboxylase Aro10p of Saccharomyces kudriavzevii and its implication in aroma development

Primer Sequence 5′–3′
Cloning into pGREG526
 SkARO10-aF CCTAGTACGGATTAGAAGCCGCCGAGCGGGTGACAACTTTTGATTTGTTCCCCGC
 SkARO10-aR GCGTGACATAACTAATTACATGACTCGAGGTCGACAAAGACAAAATCGGCGGC
 ScARO10-F CCTAGTACGGATTAGAAGCCGCCGAGCGGGTGACAATCTCTTAGGCATGCTCTTGG
 ScARO10-R GCGTGACATAACTAATTACATGACTCGAGGTCGACTATAATTGCGCCCACAAGTTTC
ARO10 deletion cassette
 TaARO10-NAT1-F ATGGCACCTGTTACAATTGAAAAGTTCGTAAATCAAGAAGGGTGTTTAGGTCGATGCCATC
 TaARO10-NAT1-R CTATTTTTTATTTCTTTTAAGTGCCGCTGCTTCAACCATGGGATGGCGGCGTTAGTATCG
Integration fragment
 pGSkARO10f TAAAGTTTATTTACAAGATAACAAAGAAACTCCCTTAAGCATGACGCCTGTTACAATTAA
 pGScARO10f TAAAGTTTATTTACAAGATAAC
 pG-ARO10-R ACAATTGGTAGCAGTGTTTTATAATTGCGCCCACAAGTTTCTCACTATAGGGCGAATTGG
Diagnostic
 T73AR10-UF ATCTCTTAGGCATGCTCTTGG
 K2 GGGACAATTCAACGCGTCTG
 K3 CCTCGACATCATCTGCCC
 ScARO10-R1 GAAGTCACCAGGAACACCG
 SkARO10-R1 CATTGGAAACAAGGTGCGG